Previous Contig 008471:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006P09Sequence533000355 (9)sp|Q9LKA5|UMP1_ARATH8e-50Unknown mitochondrial protein At3g15000.>gb:BT015868_1642486 Arabidopsis thalian703008471 (8)gb:AF253404_4930430.002Streptococcus pneumoniae strain 60 PspA (pspA) gene, partial cds.
JMFF011B24Sequence525000355 (9)sp|Q9LKA5|UMP1_ARATH2e-49Unknown mitochondrial protein At3g15000.>gb:BT015868_1642486 Arabidopsis thalian684008471 (8)gb:AF253404_4930430.002Streptococcus pneumoniae strain 60 PspA (pspA) gene, partial cds.
JMFF014B05Sequence524000355 (9)sp|Q9LKA5|UMP1_ARATH2e-49Unknown mitochondrial protein At3g15000.>gb:BT015868_1642486 Arabidopsis thalian474008471 (8)
JMFF014O03Sequence687008471 (8)gb:AF253404_4930430.003Streptococcus pneumoniae strain 60 PspA (pspA) gene, partial cds.
JMFF019I06Sequence525000355 (9)sp|Q9LKA5|UMP1_ARATH2e-49Unknown mitochondrial protein At3g15000.>gb:BT015868_1642486 Arabidopsis thalian616008471 (8)gb:AF071816_4762330.040Streptococcus pneumoniae strain EF3296 PspA (pspA) gene, partial cds.
JMFF029K03Sequence525000355 (9)sp|Q9LKA5|UMP1_ARATH3e-43Unknown mitochondrial protein At3g15000.>gb:BT015868_1642486 Arabidopsis thalian661008471 (8)gb:AF253404_4930430.001Streptococcus pneumoniae strain 60 PspA (pspA) gene, partial cds.
JMFF034L06Sequence521000355 (9)sp|Q9LKA5|UMP1_ARATH9e-49Unknown mitochondrial protein At3g15000.>gb:BT015868_1642486 Arabidopsis thalian666008471 (8)gb:AF253404_4930430.012Streptococcus pneumoniae strain 60 PspA (pspA) gene, partial cds.
JMFF037A24Sequence627000355 (9)sp|Q9LKA5|UMP1_ARATH2e-68Unknown mitochondrial protein At3g15000.>gb:BT015868_1642486 Arabidopsis thalian650008471 (8)gb:AF071816_4762330.045Streptococcus pneumoniae strain EF3296 PspA (pspA) gene, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF011B24+ GGCCCAAACCAGGGCAANTATG
rJMFF014O03+ GGCCCAANCCAGGGCAANTATG
rJMFF034L06+ CCAAACCAGGGCAACTATG
rJMFF029K03+ GGCCCAAACCAGGGCAACTATG
rJMFF006P09+ GCCAAANTATCAACNTGCTCCAGGCCCAAACCAGGGCAACTATG
                      ____________________________________________________________
consensus GCCAAANTATCAACNTGCTCCAGGCCCAAACCAGGGCAACTATG
 
. : . : . : . : . : . :
rJMFF011B24+ CGCNGGGCCCAAACCAGGGAAACTTTGCTCCGGGACCAAACCAGGGCAACAACAATCCGA
rJMFF014O03+ CGCCGGGCCCAAACCAGGGAAACTTTGCTCCGGGACCAAACCAGGGCAACAACAATCCGA
rJMFF034L06+ CGCCGGGCCCAAACCAGGGAAACTTTGCTCCGGGACCAAACCAGGGCAACAACAATCCGA
rJMFF037A24+ CCAAACCAGGGAAACTTNGCTCCGGGACCAAACCAGGGCAACAACAATCCGA
rJMFF029K03+ CGCCGGGCCCAAACCAGGGAAACTTTGCTCCGGGACCAAACCAGGGCAACAACAATCCGA
rJMFF019I06+ CGGGACCAAACCAGGGCAACAACAATCCGA
rJMFF006P09+ CGCCGGGCCCAAACCAGGGAAACTTTGCTCCGGGACCAAACCAGGGCAACAACAATCCGA
                      ____________________________________________________________
consensus CGCCGGGCCCAAACCAGGGAAACTTTGCTCCGGGACCAAACCAGGGCAACAACAATCCGA
 
. : . : . : . : . : . :
rJMFF011B24+ GCAACTATGGTCCAGGACCCAACCAGAGCAACTCTGCTTCATGGCCAAACCAGAACAGCT
rJMFF014O03+ GCAACTATGGTCCAGGACCCAACCAGAGCAACTNTGCTTCATGGCCAAACCAGAACAGCT
rJMFF034L06+ GCAACTATGGTCCAGGACCCAACCAGAGCAACTNTGCTTCATGGCCAAACCAGAACAGCT
rJMFF037A24+ GCAACTATGGTCCAGGACCCAACCAGAGCAACTCTGCTTCATGGCCAAACCAGAACAGCT
rJMFF029K03+ GCAACTATGGTCCAGGACCCAACCAGAGCAACTCTGCTTCATGGCCAAACCAGAACAGCT
rJMFF019I06+ GCAACTATGGTCCAGGACCCAACCAGAGCAACTCTGCTTCATGGCCAAACCAGAACAGCT
rJMFF006P09+ GCAACTATGGTCCAGGACCCAACCAGAGCAACTCTGCTTCATGGCCAAACCAGAACAGCT
                      ____________________________________________________________
consensus GCAACTATGGTCCAGGACCCAACCAGAGCAACTCTGCTTCATGGCCAAACCAGAACAGCT
 
. : . : . : . : . : . :
rJMFF011B24+ CTGCCCCAGGCCCAAACCAGAACAACTATGCACCAGGGCAGAACCAGAACTACCCTCCTC
rJMFF014O03+ CTGCCCCAGGCCCAAACCAGAACAACTATGCACCAGGGCAGAACCAGAACTACCCTCCTC
rJMFF034L06+ CTGCCCCAGGCCCAAACCAGAACAACTATGCACCAGGGCAGAACCAGAACTACCCTCCTC
rJMFF037A24+ CTGCCCCAGGCCCAAACCAGAACAACTATGCACCAGGGCAGAACCAGAACTACCCTCCTC
rJMFF029K03+ CTGCCCCAGTCCCAAACCAGAACAACTATGCACCAGGGCAGAACCAGAACTACCCTCCTC
rJMFF019I06+ CTGCCCCAGGCCCAAACCAGAACAACTATGCACCAGGGCAGAACCAGAACTACCCTCCTC
rJMFF006P09+ CTGCCCCAGGCCCAAACCAGAACAACTATGCACCAGGGCAGAACCAGAACTACCCTCCTC
                      ____________________________________________________________
consensus CTGCCCCAGGCCCAAACCAGAACAACTATGCACCAGGGCAGAACCAGAACTACCCTCCTC
 
. : . : . : . : . : . :
rJMFF011B24+ CGCCTGGGCCAAACCAGCACAATTACCCTCCTCCTCCAGGGCCGAATCAGCACAACTACC
rJMFF014O03+ CGCCTGGGCCAAACCAGCACAATTACCCTCCTCCTCCAGGGCCGAATCAGCACAACTACC
rJMFF034L06+ CGCCTGGGCCAAACCAGCACAATTACCCTCCTCCTCCAGGGCCGAATCAGCACAACTACC
rJMFF037A24+ CGCCTGGGCCAAACCAGCACAATTACCCTCCTCCTCCAGGGCCGAATCAGCACAACTACC
rJMFF029K03+ CGCCTGGGCCAAACCAGCACAATTACCCTCCTCCTCCAGGGCCGAATCAGCACAACTACC
rJMFF019I06+ CGCCTGGGCCAAACCAGCACAATTACCCTCCTCCTCCAGGGCCGAATCAGCACAACTACC
rJMFF014B05+ CCAANCCAGCNCAATTNCCCTCCTCCTCCAGGGCCGAATCAGCACAACTACC
rJMFF006P09+ CGCCTGGGCCAAACCAGCACAATTACCCTCCTCCTCCAGGGCCGAATCAGCACAACTACC
                      ____________________________________________________________
consensus CGCCTGGGCCAAACCAGCACAATTACCCTCCTCCTCCAGGGCCGAATCAGCACAACTACC
 
. : . : . : . : . : . :
rJMFF011B24+ CTCCTCCAGGTCCTAACCAACACATGTCTGCTAACTATGCTCCAGGGCCAAACCCAAACT
rJMFF014O03+ CTCCTCCAGGTCCTAACCAACACATGTCTGCTAACTATGCTCCAGGGCCAAACCCAAACT
rJMFF034L06+ CTCCTCCAGGTCCTAACCAACACATGTCTGCTAACTATGCTCCAGGGCCAAACCCAAACT
rJMFF037A24+ CTCCTCCAGGTCCTAACCAACACATGTCTGCTAACTATGCTCCAGGGCCAAACCCAAACT
rJMFF029K03+ CTCCTCCAGGTCCTAACCAACACATGTCTGCTAACTATGCTCCAGGG------CCAAACT
rJMFF019I06+ CTCCTCCAGGTCCTAACCAACACATGTCTGCTAACTATGCTCCAGGGCCAAACCCAAACT
rJMFF014B05+ CTCCTCCAGGTCCTAACCAACACATGTCTGCTAACTATGCTCCAGGGCCAAACCCAAACT
rJMFF006P09+ CTCCTCCAGGTCCTAACCAACACATGTCTGCTAACTATGCTCCAGGGCCAAACCCAAACT
                      ____________________________________________________________
consensus CTCCTCCAGGTCCTAACCAACACATGTCTGCTAACTATGCTCCAGGGCCAAACCCAAACT
 
. : . : . : . : . : . :
rJMFF011B24+ ACTATTCTCAAGGGCCTAATCAGAACAATTATGCTCCAAACATGGATGGCAGAAACCCTT
rJMFF014O03+ ACTATTCTCAAGGGCCTAATCAGAACAATTATGCTCCAAACATGGATGGCAGAAACCCTT
rJMFF034L06+ ACTATTCTCAAGGGCCTAATCAGAACAATTATGCTCCAAACATGGATGGCAGAAACCCTT
rJMFF037A24+ ACTATTCTCAAGGGCCTAATCAGAACAATTATGCTCCAAACATGGATGGCAGAAACCCTT
rJMFF029K03+ ACTATTCTCAAGGGCCTAATCAGAACAATTATGCTCCAAACATGGATGGCAGAAACCCTT
rJMFF019I06+ ACTATTCTCAAGGGCCTAATCAGAACAATTATGCTCCAAACATGGATGGCAGAAACCCTT
rJMFF014B05+ ACTATTCTCAAGGGCCTAATCAGAACAATTATGCTCCAAACATGGATGGCAGAAACCCTT
rJMFF006P09+ ACTATTCTCAAGGGCCTAATCAGAACAATTATGCTCCAAACATGGATGGCAGAAACCCTT
                      ____________________________________________________________
consensus ACTATTCTCAAGGGCCTAATCAGAACAATTATGCTCCAAACATGGATGGCAGAAACCCTT
 
. : . : . : . : . : . :
rJMFF011B24+ CCCAGAATCAGAACATCCCCCC-TCCTAACTATCATCAGTAGGAACTGTGCAAAGAATGT
rJMFF014O03+ CCCAGAATCAGAACATCCCCCC-TCCTAACTATCATCAGTAGGAACTGTGCAAAGAATGT
rJMFF034L06+ CCCAGAATCAGAACATCCCCCCTNCCTAACTATCATCAGTAGGAACTGTGCAAAGAATGT
rJMFF037A24+ CCCAGAATCAGAACATCCCCCC-TCCTAACTATCATCAGTAGGAACTGTGCAAAGAATGT
rJMFF029K03+ CCCAGAATCAGAACATCCCCCC-TCCTAACTATCATCAGTAGGAACTGTGCAAAGAATGT
rJMFF019I06+ CCCAGAATCAGAACATCCCCCC-TCCTAACTATCATCAGTAGGAACTGTGCAAAGAATGT
rJMFF014B05+ CCCAGAATCAGAACATCCCCCCTTCCTAACTATCATCAGTAGGAACTGTGCAAAGAATGT
rJMFF006P09+ CCCAGAATCAGAACATCCCCCC-TCCTAACTATCATCAGTAGGAACTGTGCAAAGAATGT
                      ____________________________________________________________
consensus CCCAGAATCAGAACATCCCCCC-TCCTAACTATCATCAGTAGGAACTGTGCAAAGAATGT
 
. : . : . : . : . : . :
rJMFF011B24+ AGCTCCGGACTTCCAAAAGTTTAGGATTTTTTTGTTGAAAGGTACTATCATGAATGTTGT
rJMFF014O03+ AGCTCCGGACTTCCAAAAGTTTAGGATTTTTTTGTTGAAAGGTACTATCATGAATGTTGT
rJMFF034L06+ AGCTCCGGACTTCCAAAAGTTTAGGATTTTTTTGTTGAAAGGTACTATCATGAATGTTGT
rJMFF037A24+ AGCTCCGGACTTCCAAAAGTTTAGGATTTTTTTGTTGAAAGGTACTATCATGAATGTTGT
rJMFF029K03+ AGCTCCGGACTTCCAAAAGTTTAGGATTTTTTTGTTGAAAGGTACTATCATGAATGTTGT
rJMFF019I06+ AGCTCCGGACTTCCAAAAGTTTAGGATTTTTTTGTTGAAAGGTACTATCATGAATGTTGT
rJMFF014B05+ AGCTCCGGACTTCCAAAAGTTTAGGATTTTTTTGTTGAAAGGTACTATCATGAATGTTGT
rJMFF006P09+ AGCTCCGGACTTCCAAAAGTTTAGGATTTTTTTGTTGAAAGGTACTATCATGAATGTTGT
                      ____________________________________________________________
consensus AGCTCCGGACTTCCAAAAGTTTAGGATTTTTTTGTTGAAAGGTACTATCATGAATGTTGT
 
. : . : . : . : . : . :
rJMFF011B24+ TTGGTTTCATGATCTCATGTTAAGACTTGTTCTACAGTGAAAAATTCTGTAGTTATAATG
rJMFF014O03+ TTGGTTTCATGATCTCATGTTAAGACTTGTTCTACAGTGAAAAATTCTGTAGTTATAATG
rJMFF034L06+ TTGGTTTCATGATCTCATGTTAAGACTTGTTCTACAGTGAAAAATTCTGTAGTTATAATG
rJMFF037A24+ TTGGTTTCATGATCTCATGTTAAGACTTGTTCTACAGTGAAAAATTCTGTAGTTATAATG
rJMFF029K03+ TTGGTTTCATGATCTCATGTTAAGACTTGTTCTACAGTGAAAAATTCTGTAGTTATAATG
rJMFF019I06+ TTGGTTTCATGATCTCATGTTAAGACTTGTTCTACAGTGAAAAATTCTGTAGTTATAATG
rJMFF014B05+ TTGGTTTCATGATCTCATGTTAAGACTTGTTCTACAGTGAAAAATTCTGTAGTTATAATG
rJMFF006P09+ TTGGTTTCATGATCTCATGTTAAGACTTGTTCTACAGTGAAAAATTCTGTAGTTATAATG
                      ____________________________________________________________
consensus TTGGTTTCATGATCTCATGTTAAGACTTGTTCTACAGTGAAAAATTCTGTAGTTATAATG
 
. : . : . : . : . : . :
rJMFF011B24+ GATGTGATGTCTGTATAATTGCGTTGGTGTGTATGGCAAATGATAGCCATGGCATGGACC
rJMFF014O03+ GATGTGATGTCTGTATAATTGCGTTGGTGTGTATGGCAAATGATAGCCATGGCATGGACC
rJMFF034L06+ GATGTGATGTCTGTATAATTGCGTTGGTGTGTATGGCAAATGATAGCCATGGCATGGACC
rJMFF037A24+ GATGTGATGTCTGTATAATTGCGTTGGTGTGTATGGCAAATGATAGCCATGGCATGGACC
rJMFF029K03+ GATGTGATGTCTGTATAATTGCGTTGGTGTGTATGGCAAATGATAGCCATGGCATGGACC
rJMFF019I06+ GATGTGATGTCTGTATAATTGCGTTGGTGTGTATGGCAAATGATAGCCATGGCATGGACC
rJMFF014B05+ GATGTGATGTCTGTATAATTGCGTTGGTGTGTATGGCAAATGATAGCCATGGCATGGACC
rJMFF006P09+ GATGTGATGTCTGTATAATTGCGTTGGTGTGTATGGCAAATGATAGCCATGGCATGGACC
                      ____________________________________________________________
consensus GATGTGATGTCTGTATAATTGCGTTGGTGTGTATGGCAAATGATAGCCATGGCATGGACC
 
. : . : . : . : . : . :
rJMFF011B24+ TGTCACCAGGGAAACAATGTTGCAATGGTAGCAGCAATAGTAATGCGCTGTCTCAGCGT
rJMFF014O03+ TGTCACCAGGGAAACAATGTTGCAATGGTAGCAGCAATAGTAATGCGCTGTCTCAGCGT
rJMFF034L06+ TGTCACCAGGGAAACAATGTTGCAATGGTAGCAGCAATAGTAATGCG
rJMFF037A24+ TGTCACCAGGGAAACAATGTTGCAATGGTAGCAGCAATAGTAATGCGCTGTCTCAGCGT
rJMFF029K03+ TGTCACCAGGGAAACAATGTTGCAATGGTAGCAGCAATAGTAATGC
rJMFF019I06+ TGTCACCAGGGAAACAATGTTGCAATGGTAGCAGCAATAGTAATGCG
rJMFF014B05+ TGTCACCAGGGAAACAATGTTGCAATGGTAGCAGCAATAGTAATGCGCTGTCTCAGCGT
rJMFF006P09+ TGTCACCAGGGAAACAATGTTGCAATGGTAGCAGCAATAGTAATGCGCTGTCTCAGCGTT
                      ____________________________________________________________
consensus TGTCACCAGGGAAACAATGTTGCAATGGTAGCAGCAATAGTAATGCGCTGTCTCAGCGTT