Previous Contig 008470:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006P08Sequence473004979 (144)gb:AB038994_15192914e-40Ipomoea batatas ppo-I mRNA for polyphenol oxidase I, complete cds.182008470 (2)
JMFF043N17Sequence602004979 (144)gb:AB038994_15192918e-40Ipomoea batatas ppo-I mRNA for polyphenol oxidase I, complete cds.541008470 (2)gb:CAR275311_16451960.005Cicer arietinum partial mRNA for farnesylated protein.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF043N17+ GACAGGGAAACGGGCGGTGGTGG
                      ____________________________________________________________
consensus GACAGGGAAACGGGCGGTGGTGG
 
. : . : . : . : . : . :
rJMFF043N17+ TGAAGGTGGAGCCGAAGAAGGAGGAGGGTGCAGGGGAGGGGGAGAAGAAGGCGGAGGAGG
                      ____________________________________________________________
consensus TGAAGGTGGAGCCGAAGAAGGAGGAGGGTGCAGGGGAGGGGGAGAAGAAGGCGGAGGAGG
 
. : . : . : . : . : . :
rJMFF043N17+ AGAAGAAAGCGGAGGAAGGGAAGGATGGTGATGGCGGCGGGGAGAAGAAGGAAGGCGGCG
                      ____________________________________________________________
consensus AGAAGAAAGCGGAGGAAGGGAAGGATGGTGATGGCGGCGGGGAGAAGAAGGAAGGCGGCG
 
. : . : . : . : . : . :
rJMFF043N17+ AAAGTGGTGGCGGGGAGAAGAAGGAAGGCGAGGGGGGTGTTGAATTGCCCGAAGACCCAA
                      ____________________________________________________________
consensus AAAGTGGTGGCGGGGAGAAGAAGGAAGGCGAGGGGGGTGTTGAATTGCCCGAAGACCCAA
 
. : . : . : . : . : . :
rJMFF043N17+ AACTGGAAATGAAAAAACATGAACTCTACTACTACTACCCCCCTATACAAGCTCAATATC
                      ____________________________________________________________
consensus AACTGGAAATGAAAAAACATGAACTCTACTACTACTACCCCCCTATACAAGCTCAATATC
 
. : . : . : . : . : . :
rJMFF043N17+ ACCATCAAAGGTTTGGTGCACAAGATGGTGGGTATGGCTATGGGTACCCACAGATGCCAC
                      ____________________________________________________________
consensus ACCATCAAAGGTTTGGTGCACAAGATGGTGGGTATGGCTATGGGTACCCACAGATGCCAC
 
. : . : . : . : . : . :
rJMFF043N17+ AGATGTTCAGTGATGAGAACCCTAATGCATGTTCAGTTATGTAAATTGAATGGAACATGA
                      ____________________________________________________________
consensus AGATGTTCAGTGATGAGAACCCTAATGCATGTTCAGTTATGTAAATTGAATGGAACATGA
 
. : . : . : . : . : . :
rJMFF043N17+ GAGGGTATGTTAGTCACATGGTGGGGGGTAGTGGGTGGGGGGGGGGGGGAGGGGTCCCTC
rJMFF006P08+ GGGGGGGGGGGGGAGGGGTCCCTC
                      ____________________________________________________________
consensus GAGGGTATGTTAGTCACATGGTGGGGGGTAGTGGGTGGGGGGGGGGGGGAGGGGTCCCTC
 
. : . : . : . : . : . :
rJMFF043N17+ CATGGACAAAAACTGTGGGGGCCATCTCTTCTTCCTTTGACTGGTTGTGCTCTGCATGTG
rJMFF006P08+ CATGGACAAAAACTGTGGGGGCCATCTCTTCTTCCTTTGACTGGTTGTGCTCTGCATGTG
                      ____________________________________________________________
consensus CATGGACAAAAACTGTGGGGGCCATCTCTTCTTCCTTTGACTGGTTGTGCTCTGCATGTG
 
. : . : . : . : . : . :
rJMFF043N17+ GCCCTTGTCTGGGGCCTCATTTAGTAGTTTATGTAATG
rJMFF006P08+ GCCCTTGTCTGGGGCCTCATTTAGTAGTTTATGTAATGTCTGCAACCAGAAACTGTAGAA
                      ____________________________________________________________
consensus GCCCTTGTCTGGGGCCTCATTTAGTAGTTTATGTAATGTCTGCAACCAGAAACTGTAGAA