Previous Contig 008469:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006O12Sequence639000351 (3)gb:AY321500_15991311e-64Cucumis sativus protein kinase mRNA, complete cds.741008469 (3)gb:AP004079_18373704e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFF015C05Sequence523000351 (3)gb:AY321500_15991313e-44Cucumis sativus protein kinase mRNA, complete cds.738008469 (3)gb:AP004079_18373704e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFF037G18Sequence524000351 (3)gb:AY321500_15991313e-44Cucumis sativus protein kinase mRNA, complete cds.671008469 (3)gb:AP004079_18373701e-47Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF015C05+ AAGTGGATGCNTACAGTT
rJMFF006O12+ ACAAAGTGGATGCCTACAGTT
                      ____________________________________________________________
consensus ACAAAGTGGATGCCTACAGTT
 
. : . : . : . : . : . :
rJMFF037G18+ GCATGTCGAATC
rJMFF015C05+ TTGCTATTGTGCTGTGGGAGCTTATACATAATAAGTTGCCGTTTGAGGGCATGTCGAATC
rJMFF006O12+ TTGCTATTGTGCTGTGGGAGCTTATACATAATAAGTTGCCGTTTGAGGGCATGTCGAATC
                      ____________________________________________________________
consensus TTGCTATTGTGCTGTGGGAGCTTATACATAATAAGTTGCCGTTTGAGGGCATGTCGAATC
 
. : . : . : . : . : . :
rJMFF037G18+ TGCAGGCTGCCTATGCTGCTGCTTTCAAGAATGTAAGGCCAAGTGCCGATGATCTACCAG
rJMFF015C05+ TGCAGGCTGCCTATGCTGCTGCTTTCAAGAATGTAAGGCCAAGTGCCGATGATCTACCAG
rJMFF006O12+ TGCAGGCTGCCTATGCTGCTGCTTTCAAGAATGTAAGGCCAAGTGCCGATGATCTACCAG
                      ____________________________________________________________
consensus TGCAGGCTGCCTATGCTGCTGCTTTCAAGAATGTAAGGCCAAGTGCCGATGATCTACCAG
 
. : . : . : . : . : . :
rJMFF037G18+ AAGATTTGGCTGTGATTGTGACCTCGTGTTGGAAAGAAGATCCGAATGCTCGCCCCAACT
rJMFF015C05+ AAGATTTGGCTGTGATTGTGACCTCGTGTTGGAAAGAAGATCCGAATGCTCGCCCCAACT
rJMFF006O12+ AAGATTTGGCTGTGATTGTGACCTCGTGTTGGAAAGAAGATCCGAATGCTCGCCCCAACT
                      ____________________________________________________________
consensus AAGATTTGGCTGTGATTGTGACCTCGTGTTGGAAAGAAGATCCGAATGCTCGCCCCAACT
 
. : . : . : . : . : . :
rJMFF037G18+ TCACTCGGATTATACAGATGCTTCTGCACTATCTTTCCACAATTTCACCCCTCGAAACTC
rJMFF015C05+ TCACTCGGATTATACAGATGCTTCTGCACTATCTTTCCACAATTTCACCCCTCGAAACTC
rJMFF006O12+ TCACTCGGATTATACAGATGCTTCTGCACTATCTTTCCACAATTTCACCCCTCGAAACTC
                      ____________________________________________________________
consensus TCACTCGGATTATACAGATGCTTCTGCACTATCTTTCCACAATTTCACCCCTCGAAACTC
 
. : . : . : . : . : . :
rJMFF037G18+ CCCCGATACCTCCAAGAATTTTCACCTCGGAGAACGCTGTCTTGCCGCCAGAGTCTCCAG
rJMFF015C05+ CCCCGATACCTCCAAGAATTTTCACCTCGGAGAACGCTGTCTTGCCGCCAGAGTCTCCAG
rJMFF006O12+ CCCCGATACCTCCAAGAATTTTCACCTCGGAGAACGCTGTCTTGCCGCCAGAGTCTCCAG
                      ____________________________________________________________
consensus CCCCGATACCTCCAAGAATTTTCACCTCGGAGAACGCTGTCTTGCCGCCAGAGTCTCCAG
 
. : . : . : . : . : . :
rJMFF037G18+ GTACAAGCTCCCTAATGGCGAAGCGTGGTGACTCGGGGGATACCCCCAACGCCCCATCGG
rJMFF015C05+ GTACAAGCTCCCTAATGGCGAAGCGTGGTGACTCGGGGGATACCCCCAACGCCCCATCGG
rJMFF006O12+ GTACAAGCTCCCTAATGGCGAAGCGTGGTGACTCGGGGGATGCCCCCAACGCCCCATCGG
                      ____________________________________________________________
consensus GTACAAGCTCCCTAATGGCGAAGCGTGGTGACTCGGGGGATACCCCCAACGCCCCATCGG
 
. : . : . : . : . : . :
rJMFF037G18+ AGGATAAGCAGAAGGGTTTGTTCTTCTGCTTCAAGCAATGCTACTGATCCCTGTACCATC
rJMFF015C05+ AGGATAAGCAGAAGGGTTTGTTCTTCTGCTTCAAGCAATGCTACTGATCCCTGTACCATC
rJMFF006O12+ AGGATAAGCAGAAGGGTTTGTTCTTCTGCTTCAAGCAATGCTACTGATCCCTGTACCATC
                      ____________________________________________________________
consensus AGGATAAGCAGAAGGGTTTGTTCTTCTGCTTCAAGCAATGCTACTGATCCCTGTACCATC
 
. : . : . : . : . : . :
rJMFF037G18+ CTTCTCAAGCACAACGTAACCGAGGAACACAGTTTTAGCTGCAAATATATACGGAAATTT
rJMFF015C05+ CTTCTCAAGCACAACGTAACCGAGGAACACAGTTTTAGCTGCAAATATATACGGAAATTT
rJMFF006O12+ CTTCTCAAGCACAACGTAACCGAGGAACACAGTTTTAGCTGCAAATATATACGGAAATTT
                      ____________________________________________________________
consensus CTTCTCAAGCACAACGTAACCGAGGAACACAGTTTTAGCTGCAAATATATACGGAAATTT
 
. : . : . : . : . : . :
rJMFF037G18+ AGATGTTCTTATTAGATTCTGGAAATGAAGCTCTGCTAAGGGGAAATGAAGATGTTGCCA
rJMFF015C05+ AGATGTTCTTATTAGATTCTGGAAATGAAGCTCTGCTAAGGGGAAATGAAGATGTTGCCA
rJMFF006O12+ AGATGTTCTTATTAGATTCTGGAAATGAAGCTCTGCTAAGGGGAAATGAAGATGTTGCCA
                      ____________________________________________________________
consensus AGATGTTCTTATTAGATTCTGGAAATGAAGCTCTGCTAAGGGGAAATGAAGATGTTGCCA
 
. : . : . : . : . : . :
rJMFF037G18+ TTCTAATTTAGTTCTGACTGAATGTTGAGCTTTTGGACACTGGAGCTAAGGTTGCTGTGA
rJMFF015C05+ TTCTAATTTAGTTCTGACTGAATGTTGAGCTTTTGGACACTGGAGCTAAGGTTGCTGTGA
rJMFF006O12+ TTCTAATTTAGTTCTGACTGAATGTTGAGCTTTTGGACACTGGAGCTAAGGTTGCTGTGA
                      ____________________________________________________________
consensus TTCTAATTTAGTTCTGACTGAATGTTGAGCTTTTGGACACTGGAGCTAAGGTTGCTGTGA
 
. : . : . : . : . : . :
rJMFF037G18+ TGATTATGTAGTATTGTAGTTGTAAAATGTAAAATAAGGTTTCATCCAAATGCCTTTCCT
rJMFF015C05+ TGATTATGTAGTATTGTAGTTGTAAAATGTAAAATAAGGTTTCATCCAAATGCCTTTCCT
rJMFF006O12+ TGATTATGTAGTATTGTAGTTGTAAAATGTAAAATAAGGTTTCATCCAAATGCCTTTCCT
                      ____________________________________________________________
consensus TGATTATGTAGTATTGTAGTTGTAAAATGTAAAATAAGGTTTCATCCAAATGCCTTTCCT
 
. : . : . : . : . : . :
rJMFF037G18+ CCAATATTTTGTAAGAACATTACATTATTGACCTTTGATATATCTATCTAGTGCAGTAC
rJMFF015C05+ CCAATATTTTGTAAGAACATTACATTATTGACCTTTGATATATCTATCTAGTGCAGTAC
rJMFF006O12+ CCAATATTTTGTAAGAACATTACATTATTGACCTTTGATATATCTATCTAGTGCAGTACT
                      ____________________________________________________________
consensus CCAATATTTTGTAAGAACATTACATTATTGACCTTTGATATATCTATCTAGTGCAGTACT