Previous Contig 008466:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006N23Sequence586008466 (2)gb:AP004657_18427799e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P003778008466 (2)gb:AP004657_18427790.001Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P003

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006N23- TATCGATATATTAAACACGGAGTAAATATGAGAAATACAAGGAGGCCGGTGCGGAAGA
                      ____________________________________________________________
consensus TATCGATATATTAAACACGGAGTAAATATGAGAAATACAAGGAGGCCGGTGCGGAAGA
 
. : . : . : . : . : . :
rJMFF006N23- CACCCACGTTCCCAGAACAGACTCAGAATCAGTTGCCCTTCCAAGAGCATGAGCCACATG
                      ____________________________________________________________
consensus CACCCACGTTCCCAGAACAGACTCAGAATCAGTTGCCCTTCCAAGAGCATGAGCCACATG
 
. : . : . : . : . : . :
rJMFF006N23- ATTCGCTGACCTACGGAATCAGTTGCCCTTCCAAGAGCATGAGCCACATGATTCGCTGAC
                      ____________________________________________________________
consensus ATTCGCTGACCTACGGAATCAGTTGCCCTTCCAAGAGCATGAGCCACATGATTCGCTGAC
 
. : . : . : . : . : . :
JMFF006N23+ TACAAATATGACGAACAGTAATGTTCCCAATATCCCTAACAATATCACGACATTACTTA
rJMFF006N23- CTACAAATATGACGAACAGTAATGTTCCCAATATCCCTAACAATATCACGACATTACTTA
                      ____________________________________________________________
consensus CTACAAATATGACGAACAGTAATGTTCCCAATATCCCTAACAATATCACGACATTACTTA
 
. : . : . : . : . : . :
JMFF006N23+ ACAACTGCACCAACATAAGAGCATGACAAAAATTTAAATAGTCTGATTTTAAAAAAATAT
rJMFF006N23- ACAACTGCACCAACATAAGAGCATGACAAAAATTTAAATAGTCTGATTTTAAAAAAATAT
                      ____________________________________________________________
consensus ACAACTGCACCAACATAAGAGCATGACAAAAATTTAAATAGTCTGATTTTAAAAAAATAT
 
. : . : . : . : . : . :
JMFF006N23+ TATCAAGACTAAGGTCCTTGAGCCATTTAATTGCTTCTTTTACCGCCATCGTCTTCACTA
rJMFF006N23- TATCAAGACTAAGGTCCTTGAGCCATTTAATTGCTTCTTTTACCGCCATCGTCTTCACTA
                      ____________________________________________________________
consensus TATCAAGACTAAGGTCCTTGAGCCATTTAATTGCTTCTTTTACCGCCATCGTCTTCACTA
 
. : . : . : . : . : . :
JMFF006N23+ GATAAAGGTCTTGTCCACAAGTTAATTTACAACCCAAAGCCGCAACAAAGTGGCCAGGGT
rJMFF006N23- GATAAAGGTCTTGTCCACAAGTTAATTTACAACCCAAAGCCGCAACAAAGTGGCCAGGGT
                      ____________________________________________________________
consensus GATAAAGGTCTTGTCCACAAGTTAATTTACAACCCAAAGCCGCAACAAAGTGGCCAGGGT
 
. : . : . : . : . : . :
JMFF006N23+ GGTCTCGGATTACAGCCCCATAGCCCGCATCATCCGCAAATATTGCCGCATCCACATTGC
rJMFF006N23- GGTCTCGGATTACAGCCCCATAGCCCGCATCATCCGCAAATATTGCCGCATCCACATTGC
                      ____________________________________________________________
consensus GGTCTCGGATTACAGCCCCATAGCCCGCATCATCCGCAAATATTGCCGCATCCACATTGC
 
. : . : . : . : . : . :
JMFF006N23+ ACTTAAGATGGTTGGTGGTAGGAGGTGTCCAGCAATTGGCAGAACTGGTACGTAGAGACA
rJMFF006N23- ACTTAAGATGGTTGGTGGTAGGAGGTGTCCAGCAATTGGCAGAACTGGTACGTAGAGACA
                      ____________________________________________________________
consensus ACTTAAGATGGTTGGTGGTAGGAGGTGTCCAGCAATTGGCAGAACTGGTACGTAGAGACA
 
. : . : . : . : . : . :
JMFF006N23+ CAAAAGCACTGCCATAAAATTCTTTCGAATTTGCTCTCCACACATTCACTTGCTGCTTCA
rJMFF006N23- CAAAAGCACTGCCATAAAATTCTTTCGAATTTGCTCTCCACACATTCACTTGCTGCTTCA
                      ____________________________________________________________
consensus CAAAAGCACTGCCATAAAATTCTTTCGAATTTGCTCTCCACACATTCACTTGCTGCTTCA
 
. : . : . : . : . : . :
JMFF006N23+ AGCCGAAACAAATTATCAACGCCCAGATTGCCGCAGAATTGAGACGAAGCTGCCAATCGA
rJMFF006N23- AGCCGAAACAAATTATCAACGCCCAGATTGCCGCAGAATTGAGACGAAGCTGCCAATCGA
                      ____________________________________________________________
consensus AGCCGAAACAAATTATCAACGCCCAGATTGCCGCAGAATTGAGACGAAGCTGCCAATCGA
 
. : . : . : . : . : . :
JMFF006N23+ ACGGAATTTTGGTGCGAAAGAAATCTGCTATGCCGGAATTTCGAAACTACCGCCACTGAA
rJMFF006N23- ACGGAATTTTGGTGCGAAAGAAATCTGCTATGCCGGAATTTCGAAACTACCGCCACTGAA
                      ____________________________________________________________
consensus ACGGAATTTTGGTGCGAAAGAAATCTGCTATGCCGGAATTTCGAAACTACCGCCACTGAA
 
. : . : . : . : . : . :
JMFF006N23+ CGGAAATCATTGCCGCCGCCTCCGGAATTCGTCCGGAGTTAATTGAT
rJMFF006N23- CGGAAATCATTGCCGCCGCCTCCGGAATTCGTCCGGAGTTAATTGATCGGNTCTCGACGA
                      ____________________________________________________________
consensus CGGAAATCATTGCCGCCGCCTCCGGAATTCGTCCGGAGTTAATTGATCGGNTCTCGACGA