Previous Contig 008459:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006M06Sequence551008459 (2)804008459 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF006M06- AA
                      ____________________________________________________________
consensus AA
 
. : . : . : . : . : . :
JMFF006M06- TTACCATCCATAATTTTGACTTGTACGGACTCTCTCTCTCTCTCTCTATCTATCATGACC
                      ____________________________________________________________
consensus TTACCATCCATAATTTTGACTTGTACGGACTCTCTCTCTCTCTCTCTATCTATCATGACC
 
. : . : . : . : . : . :
JMFF006M06- TTGCGTTTTCCAACACTTTCCACGCCGTCGAAAGGGTGCTTCATTAGTTGCCCGGACGAT
                      ____________________________________________________________
consensus TTGCGTTTTCCAACACTTTCCACGCCGTCGAAAGGGTGCTTCATTAGTTGCCCGGACGAT
 
. : . : . : . : . : . :
JMFF006M06- GGGGCAAAGCGGTGGGGATTGCGGTGGAGCAAAGCGGCAGGGTCCACCTTCAAGGGCTGT
                      ____________________________________________________________
consensus GGGGCAAAGCGGTGGGGATTGCGGTGGAGCAAAGCGGCAGGGTCCACCTTCAAGGGCTGT
 
. : . : . : . : . : . :
JMFF006M06- AGGTCCAGCCATCTATACATGGGGGTGAGCCTAGTCGGTGTCCGTCTGGCGGACCTATTT
                      ____________________________________________________________
consensus AGGTCCAGCCATCTATACATGGGGGTGAGCCTAGTCGGTGTCCGTCTGGCGGACCTATTT
 
. : . : . : . : . : . :
JMFF006M06- GTCAAGCCCCTTTCAAACCTTCCAAGGGTGTTACTATCCCGCCGGATGCCTTGCCTTTGC
rJMFF006M06+ TCCCGCCGGATGCCTTGCCTTTGC
                      ____________________________________________________________
consensus GTCAAGCCCCTTTCAAACCTTCCAAGGGTGTTACTATCCCGCCGGATGCCTTGCCTTTGC
 
. : . : . : . : . : . :
JMFF006M06- AACTGTCCTATCTGGATTTGGGGTTGCCCCATTATAACAATCCAGAAGAGTTGGTTATTT
rJMFF006M06+ AACTGTCCTATCTGGATTTGGGGTTGCCCCATTATAACAATCCAGAAGAGTTGGTTATTT
                      ____________________________________________________________
consensus AACTGTCCTATCTGGATTTGGGGTTGCCCCATTATAACAATCCAGAAGAGTTGGTTATTT
 
. : . : . : . : . : . :
JMFF006M06- GCAACTGGTTGTTGTGTGCAGCGGAGGGGAACATGGAGGAGATTTTGGTTGATGTGGGTG
rJMFF006M06+ GCAACTGGTTGTTGTGTGCAGCGGAGGGGAACATGGAGGAGATTTTGGTTGATGTGGGTG
                      ____________________________________________________________
consensus GCAACTGGTTGTTGTGTGCAGCGGAGGGGAACATGGAGGAGATTTTGGTTGATGTGGGTG
 
. : . : . : . : . : . :
JMFF006M06- GTAGTGTGGCGCGGTGGATGGCCTTGGTGTCTTTGGCACCCGGGTATTTGGTTGAGTTTG
rJMFF006M06+ GTAGTGTGGCGCGGTGGATGGCCTTGGTGTCTTTGGCACCCGGGTATTTGGTTGAGTTTG
                      ____________________________________________________________
consensus GTAGTGTGGCGCGGTGGATGGCCTTGGTGTCTTTGGCACCCGGGTATTTGGTTGAGTTTG
 
. : . : . : . : . : . :
JMFF006M06- GTGTTCTAGATTCATGGGCGTGTCTGTTAAATTGTCGAGAGCGGTATAAGGAATCNAATG
rJMFF006M06+ GTGTTCTAGATTCATGGGCGTGTCTGTTAAATTGTCGAGAGCGGTATAAGGAATCGAATG
                      ____________________________________________________________
consensus GTGTTCTAGATTCATGGGCGTGTCTGTTAAATTGTCGAGAGCGGTATAAGGAATCGAATG
 
. : . : . : . : . : . :
JMFF006M06- CCCCTTCTC
rJMFF006M06+ CCCCTTCTCGATTTTTTGCCTCCAATCTTTCCAGCTTCGTACTGTCGTGGATGCCTCCCT
                      ____________________________________________________________
consensus CCCCTTCTCGATTTTTTGCCTCCAATCTTTCCAGCTTCGTACTGTCGTGGATGCCTCCCT
 
. : . : . : . : . : . :
rJMFF006M06+ TGATTGGGATAAGTGTATTGCTTCCTTCTATGCGTTGATTTCTGAAAATACCGGTTTGAA
                      ____________________________________________________________
consensus TGATTGGGATAAGTGTATTGCTTCCTTCTATGCGTTGATTTCTGAAAATACCGGTTTGAA
 
. : . : . : . : . : . :
rJMFF006M06+ ATAATTGATAATTCGACTCTTCAGCCTAATACAAAGCATAAATATGGTGATTTCCCGCAC
                      ____________________________________________________________
consensus ATAATTGATAATTCGACTCTTCAGCCTAATACAAAGCATAAATATGGTGATTTCCCGCAC
 
. : . : . : . : . : . :
rJMFF006M06+ AAGTTGGTATGTTATATATTTCGCCCAGTCTGCACTATTCATCCGGGGAGGTCTACGATG
                      ____________________________________________________________
consensus AAGTTGGTATGTTATATATTTCGCCCAGTCTGCACTATTCATCCGGGGAGGTCTACGATG
 
. : . : . : . : . : . :
rJMFF006M06+ TGTGCGTGTTTTGGAGCCAAAGCACATGCAGATGAGTTGGTGTGATTGCAAGAATAAGGT
                      ____________________________________________________________
consensus TGTGCGTGTTTTGGAGCCAAAGCACATGCAGATGAGTTGGTGTGATTGCAAGAATAAGGT
 
. : . : . : . : . : . :
rJMFF006M06+ TGACTGCGGGGTCTATGTCATGCGTCATATGGAGTCTTACATGGGGCAAGGAGTGACTAG
                      ____________________________________________________________
consensus TGACTGCGGGGTCTATGTCATGCGTCATATGGAGTCTTACATGGGGCAAGGAGTGACTAG
 
. : . : . : . : . : . :
rJMFF006M06+ ATGGAGGTGTGGTCTTACCAAAGGTAACATTGCTCAGCTCAAGAAGTTGAGGTTACACTA
                      ____________________________________________________________
consensus ATGGAGGTGTGGTCTTACCAAAGGTAACATTGCTCAGCTCAAGAAGTTGAGGTTACACTA
 
. : . : . : . : . : . :
rJMFF006M06+ CATGAAGGAAATTGCAACATTAGAATTCAATTTACTTAAGTCTAGGAATATTTCTCGGGC
                      ____________________________________________________________
consensus CATGAAGGAAATTGCAACATTAGAATTCAATTTACTTAAGTCTAGGAATATTTCTCGGGC
 
. : . : . : . : . : . :
rJMFF006M06+ GTATCAGTTCGTGTAATCGATCCCGTTGGTCCGGAGTGGGTTTCGTGCCCTTGGGTTAAT
                      ____________________________________________________________
consensus GTATCAGTTCGTGTAATCGATCCCGTTGGTCCGGAGTGGGTTTCGTGCCCTTGGGTTAAT