Previous Contig 008443:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006J10Sequence574008443 (7)gb:AY045965_15614625e-56Arabidopsis thaliana unknown protein (At4g32590) mRNA, complete cds.>gb:AY133803744008443 (7)gb:AY045965_15614629e-56Arabidopsis thaliana unknown protein (At4g32590) mRNA, complete cds.>gb:AY133803
JMFN012N17Sequence609008443 (7)gb:AY045965_15614623e-55Arabidopsis thaliana unknown protein (At4g32590) mRNA, complete cds.>gb:AY133803
JMSF014J06Sequence559008443 (7)gb:AY045965_15614627e-52Arabidopsis thaliana unknown protein (At4g32590) mRNA, complete cds.>gb:AY133803737008443 (7)gb:AY045965_15614621e-51Arabidopsis thaliana unknown protein (At4g32590) mRNA, complete cds.>gb:AY133803
JMSF022J06Sequence138008443 (7)gb:AC093956_17362056e-11Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1263_E10, complete s
JMSF042O16Sequence759008443 (7)gb:AY045965_15614629e-56Arabidopsis thaliana unknown protein (At4g32590) mRNA, complete cds.>gb:AY133803

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014J06+ GTAGCAT
JMFF006J10- GCAGACAGTAGCAT
JMSF014J06- GTAGCAT
JMSF042O16- GGGTGGATCAGAAAGCAGACAGTAGCAT
                      ____________________________________________________________
consensus GGGTGGATCAGAAAGCAGACAGTAGCAT
 
. : . : . : . : . : . :
rJMSF014J06+ GGCTGCCACGAACCTGGCAGTGCCCACCACATTCCGGCCGCCACAATTTACACCTACCAT
JMFF006J10- GGCTGCCACGAACCTGGCAGTGCCCACCACATTCCGGCCGCCACAATTTACACCTACCAT
JMSF014J06- GGCTGCCACGAACCTGGCAGTGCCCACCACATTCCGGCCGCCACAATTTACACCTACCAT
JMSF042O16- GGCTGCCACGAACCTGGCAGTGCCCACCACATTCCGGCCGCCACAATTTACACCTACCAT
rJMFF006J10+ GGCCGCCACAATTTACACCTACCAT
                      ____________________________________________________________
consensus GGCTGCCACGAACCTGGCAGTGCCCACCACATTCCGGCCGCCACAATTTACACCTACCAT
 
. : . : . : . : . : . :
rJMSF014J06+ CGCCGTTAACCACCGCAGACCCACCACCAGCACCACCAGAAAGAAACGCATTTCCATCTC
JMFF006J10- CGCCGTTAACCACCGCAGACCCACCACCAGCACCACCAGAAAGAAACGCATTTCCATCTC
JMSF014J06- CGCCGTTAACCACCGCAGACCCACCACCAGCACCACCAGAAAGAAACGCATTTCCATCTC
JMSF042O16- CGCCGTTAACCACCGCAGACCCACCACCAGCACCACCAGAAAGAAACGCATTTCCATCTC
rJMFF006J10+ CGCCGTTAACCACCGCAGACCCACCACCAGCACCACCAGAAAGAAACGCATTTCCATCTC
                      ____________________________________________________________
consensus CGCCGTTAACCACCGCAGACCCACCACCAGCACCACCAGAAAGAAACGCATTTCCATCTC
 
. : . : . : . : . : . :
rJMSF014J06+ TTGCACCGCGGCGTCGCTGGAATCTTCCTCGCCCACAACTGAAAAGCCTCTAATCGAGCT
JMFF006J10- TTGCACCGCGGCGTCGCTGGAATCTTCCTCGCCCACAACTGAAAAGCCTCTAATCGAGCT
JMSF014J06- TTGCACCGCGGCGTCGCTGGAATCTTCCTCGCCCACAACTGAAAAGCCTCTAATCGAGCT
JMSF042O16- TTGCACCGCGGCGTCGCTGGAATCTTCCTCGCCCACAACTGAAAAGCCTCTAATCGAGCT
JMFN012N17+ CTGAAAAGCCTCTAATCGAGCT
rJMFF006J10+ TTGCACCGCGGCGTCGCTGGAATCTTCCTCGCCCACAACTGAAAAGCCTCTAATCGAGCT
                      ____________________________________________________________
consensus TTGCACCGCGGCGTCGCTGGAATCTTCCTCGCCCACAACTGAAAAGCCTCTAATCGAGCT
 
. : . : . : . : . : . :
rJMSF014J06+ AGAGTTCATAGGGCCAAAAGCAGAGGCGGATGGGAAGTACCCAGTCGATAAAGCCACGGC
rJMSF022J06+ AAAAGCAGAGGCGGATGGGAAGTANNCNGTCGATAANGNCGNGGC
JMFF006J10- AGAGTTCATAGGGCCAAAAGCAGAGGCGGATGGGAAGTACCCAGTCGATAAAGCCACGGC
JMSF014J06- AGAGTTCATAGGGCCAAAAGCAGAGGCGGATGGGAAGTACCCAGTCGATAAAGCCACGGC
JMSF042O16- AGAGTTCATAGGGCCAAAAGCAGAGGCGGATGGGAAGTACCCAGTCGATAAAGCCACGGC
JMFN012N17+ AGAGTTCATAGGGCCAAAAGCAGAGGCGGATGGGAAGTACCCAGTCGATAAAGCCACGGC
rJMFF006J10+ AGAGTTCATAGGGCCAAAAGCAGAGGCGGATGGGAAGTACCCAGTCGATAAAGCCACGGC
                      ____________________________________________________________
consensus AGAGTTCATAGGGCCAAAAGCAGAGGCGGATGGGAAGTACCCAGTCGATAAAGCCACGGC
 
. : . : . : . : . : . :
rJMSF014J06+ AGTTAGTGGTGAGAAGCTTCTTAGGAATATAATGGCGGATAACAAGATTGAGCTTTACGC
rJMSF022J06+ AGTTAGTGGTGAGAAGCTTCTTAGGAATATAATGGTGGATAACAAGATTGAGCTCTACGC
JMFF006J10- AGTTAGTGGTGAGAAGCTTCTTAGGAATATAATGGCGGATAACAAGATTGAGCTTTACGC
JMSF014J06- AGTTAGTGGTGAGAAGCTTCTTAGGAATATAATGGCGGATAACAAGATTGAGCTTTACGC
JMSF042O16- AGTTAGTGGTGAGAAGCTTCTTAGGAATATAATGGCGGATAACAAGATTGAGCTTTACGC
JMFN012N17+ AGTTAGTGGTGAGAAGCTTCTTAGGAATATAATGGCGGATAACAAGATTGAGCTTTACGC
rJMFF006J10+ AGTTAGTGGTGAGAAGCTTCTTAGGAATATAATGGCGGATAACAAGATTGAGCTTTACGC
                      ____________________________________________________________
consensus AGTTAGTGGTGAGAAGCTTCTTAGGAATATAATGGCGGATAACAAGATTGAGCTTTACGC
 
. : . : . : . : . : . :
rJMSF014J06+ TGCCTATGGGAAAGTGATGAATTGTGGAGGTGGTGGAAGTTGTGGTACTTGTATTGTGGA
rJMSF022J06+ TGCCTATGGGAAAGTGATGAATNGTGGAGGTGG
JMFF006J10- TGCCTATGGGAAAGTGATGAATTGTGGAGGTGGTGGAAGTTGTGGTACTTGTATTGTGGA
JMSF014J06- TGCCTATGGGAAAGTGATGAATTGTGGAGGTGGTGGAAGTTGTGGTACTTGTATTGTGGA
JMSF042O16- TGCCTATGGGAAAGTGATGAATTGTGGAGGTGGTGGAAGTTGTGGTACTTGTATTGTGGA
JMFN012N17+ TGCCTATGGGAAAGTGATGAATTGTGGAGGTGGTGGAAGTTGTGGTACTTGTATTGTGGA
rJMFF006J10+ TGCCTATGGGAAAGTGATGAATTGTGGAGGTGGTGGAAGTTGTGGTACTTGTATTGTGGA
                      ____________________________________________________________
consensus TGCCTATGGGAAAGTGATGAATTGTGGAGGTGGTGGAAGTTGTGGTACTTGTATTGTGGA
 
. : . : . : . : . : . :
rJMSF014J06+ GATTATAGATGGAAAAGATCTCTTAAACGAGAGGACAAATACAGAACTCCGATATCTAAA
JMFF006J10- GATTATAGATGGAAAAGATCTCTTAAACGAGAGGACAAATACAGAACTCCGATATCTAAA
JMSF014J06- GATTATAGATGGAAAAGATCTCTTAAACGAGAGGACAAATACAGAACTCCGATATCTAAA
JMSF042O16- GATTATAGATGGAAAAGATCTCTTAAACGAGAGGACAAATACAGAACTCCGATATCTAAA
JMFN012N17+ GATTATAGATGGAAAAGATCTCTTAAACGAGAGGACAAATACAGAACTCCGATATCTAAA
rJMFF006J10+ GATTATAGATGGAAAAGATCTCTTAAACGAGAGGACAAATACAGAACTCCGATATCTAAA
                      ____________________________________________________________
consensus GATTATAGATGGAAAAGATCTCTTAAACGAGAGGACAAATACAGAACTCCGATATCTAAA
 
. : . : . : . : . : . :
rJMSF014J06+ GAAGAAAACCAGAGTCATGGAGGCTAGCATGCCAGACAATAGTTGGAAATAAAGAGAACT
JMFF006J10- GAAG-AAACCAGAGTCATGGAGGCTAGCATGCCAGACAATAGTTGGAAATAAAGAGAACT
JMSF014J06- GAAGAAAACCAGAGTCATGGAGGCTAGCATGCCAGACAATAGTTGGAAATAAAGAGAACT
JMSF042O16- GAAG-AAACCAGAGTCATGGAGGCTAGCATGCCAGACAATAGTTGGAAATAAAGAGAACT
JMFN012N17+ GAAG-AAACCAGAGTCATGGAGGCTAGCATGCCAGACAATAGTTGGAAATAAAGAGAACT
rJMFF006J10+ GAAG-AAACCAGAGTCATGGAGGCTAGCATGCCAGACAATAGTTGGAAATAAAGAGAACT
                      ____________________________________________________________
consensus GAAG-AAACCAGAGTCATGGAGGCTAGCATGCCAGACAATAGTTGGAAATAAAGAGAACT
 
. : . : . : . : . : . :
rJMSF014J06+ CTGGCAAGGTAGTAGTCCAGAGGCTGCCTCAATGGAAGAAGTGAAAGCAAATAAAATACC
JMFF006J10- CTGGCAAGGTAGTAGTCCAGAGGCTGCCTCAATGGAAGAAGTGAAAGCAAATAAAATACC
JMSF014J06- CTGGCAAGGTAGTAGTCCAGAGGCTGCCTCAATGGAAGAAGTGAAAGCAAATAAAATACC
JMSF042O16- CTGGCAAGGTAGTAGTCCAGAGGCTGCCTCAATGGAAGAAGTGAAAGCAAATAAAATACC
JMFN012N17+ CTGGCAAGGTAGTAGTCCAGAGGCTGCCTCAATGGAAGAAGTGAAAGCAAATAAAATACC
rJMFF006J10+ CTGGCAAGGTAGTAGTCCAGAGGCTGCCTCAATGGAAGAAGTGAAAGCAAATAAAATACC
                      ____________________________________________________________
consensus CTGGCAAGGTAGTAGTCCAGAGGCTGCCTCAATGGAAGAAGTGAAAGCAAATAAAATACC
 
. : . : . : . : . : . :
rJMSF014J06+ ATTCTGAAAACAGCAAACAACCCAGTGAAGAAATTCAAAGAAACATAAATATACAACAAC
JMFF006J10- ATTCTGAAA
JMSF014J06- ATTCTGAAAA
JMSF042O16- ATTCTGAAAACAGCAAACAACCCAGTGAAGAAATTCAAAGAAACATAAATATACAACAAC
JMFN012N17+ ATTCTGAAAACAGCAAACAACCCAGTGAAGAAATTCAAAGAAACATAAATATACAACAAC
rJMFF006J10+ ATTCTGAAAACAGCAAACAACCCAGTGAAGAAATTCAAAGAAACATAAATATACAACAAC
                      ____________________________________________________________
consensus ATTCTGAAAACAGCAAACAACCCAGTGAAGAAATTCAAAGAAACATAAATATACAACAAC
 
. : . : . : . : . : . :
rJMSF014J06+ AACAACCCCCTCTCCCCATTGTGAGTAGTGAAATGTAGGAACCTATCTGCACTTGTACAC
JMSF042O16- AACAACCCCCTCTCCCCATTGTGAGTAGTGAAATGTAGGAACCTATCTGCACTTGTACAC
JMFN012N17+ AACAACCCCCTCTCCCCATTGTGAGTAGTGAAATGTAGGAACCTATCTGCACTTGTACAC
rJMFF006J10+ AACAACCCCCTCTCCCCATTGTGAGTAGTGAAATGTAGGAACCTATCTGCACTTGTACAC
                      ____________________________________________________________
consensus AACAACCCCCTCTCCCCATTGTGAGTAGTGAAATGTAGGAACCTATCTGCACTTGTACAC
 
. : . : . : . : . : . :
rJMSF014J06+ ATGAACTTGTTAACCATGCAACAATGTTCTTTTACTCAAAAAGGAAGCCAGAGTTCAATT
JMSF042O16- ATGAACTTGTTAACCATGCAACAATGTTCTTTTACTCAAAAAGGAAGCCAGAGTTCAATT
JMFN012N17+ ATGAACTTGTTAACCATGCAACAATGTTCTTTTACTCAAAAAGGAAGCCAGAGTTCAATT
rJMFF006J10+ ATGAACTTGTTAACCATGCAACAATGTTCTTTTACTCAAAAAGGAAGCCAGAGTTCAATT
                      ____________________________________________________________
consensus ATGAACTTGTTAACCATGCAACAATGTTCTTTTACTCAAAAAGGAAGCCAGAGTTCAATT
 
. : . : . : . : . : . :
rJMSF014J06+ TTAC
JMSF042O16- TTAC
JMFN012N17+ TTAC
rJMFF006J10+ TTACACATTACACTTGTGTAATATACTAATATTATGTAAGAGTTTCTTCATCTCTATAAC
                      ____________________________________________________________
consensus TTACACATTACACTTGTGTAATATACTAATATTATGTAAGAGTTTCTTCATCTCTATAAC