Previous Contig 008442:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005D19Sequence504008120 (7)gb:AF124842_17703221e-58Capsicum annuum squalene synthase (SS) mRNA, complete cds.664008442 (12)sp|P53800|FDFT_NICBE5e-74Farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21) (Squalene synthetase) (SQ
JMFF006J06Sequence549008120 (7)gb:AF124842_17703224e-72Capsicum annuum squalene synthase (SS) mRNA, complete cds.769008442 (12)sp|P53800|FDFT_NICBE3e-80Farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21) (Squalene synthetase) (SQ
JMFF006P12Sequence581008120 (7)gb:AF124842_17703229e-75Capsicum annuum squalene synthase (SS) mRNA, complete cds.800008442 (12)sp|P53800|FDFT_NICBE2e-86Farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21) (Squalene synthetase) (SQ
JMFF036F03Sequence606008120 (7)gb:AF124842_17703221e-89Capsicum annuum squalene synthase (SS) mRNA, complete cds.590008442 (12)sp|P53800|FDFT_NICBE4e-68Farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21) (Squalene synthetase) (SQ
JMFF036J16Sequence546005864 (4)gb:AF124842_17703228e-75Capsicum annuum squalene synthase (SS) mRNA, complete cds.723008442 (12)sp|P53800|FDFT_NICBE2e-72Farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21) (Squalene synthetase) (SQ
JMFF040O18Sequence549005864 (4)gb:AF124842_17703228e-75Capsicum annuum squalene synthase (SS) mRNA, complete cds.797008442 (12)sp|P53800|FDFT_NICBE1e-88Farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21) (Squalene synthetase) (SQ
JMFS110G07Sequence618008442 (12)gb:AB022599_15152414e-89Solanum tuberosum PSS1 mRNA for squalene synthase, complete cds.
JMSF020A01Sequence696005864 (4)gb:AF124842_17703225e-90Capsicum annuum squalene synthase (SS) mRNA, complete cds.791008442 (12)sp|P53800|FDFT_NICBE6e-82Farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21) (Squalene synthetase) (SQ
JMSF022L18Sequence647008120 (7)gb:NTU60057_16918482e-84Nicotiana tabacum squalene synthase mRNA, complete cds.790008442 (12)sp|P53800|FDFT_NICBE3e-89Farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21) (Squalene synthetase) (SQ
JMSF023L18Sequence753008442 (12)sp|P53800|FDFT_NICBE5e-75Farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21) (Squalene synthetase) (SQ
JMSF046I02Sequence466008120 (7)gb:AF124842_17703224e-54Capsicum annuum squalene synthase (SS) mRNA, complete cds.657008442 (12)sp|P53800|FDFT_NICBE2e-80Farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21) (Squalene synthetase) (SQ
JMSF052J06Sequence646008120 (7)gb:AF124842_17703223e-91Capsicum annuum squalene synthase (SS) mRNA, complete cds.796008442 (12)gb:NTU60057_1691848e-106Nicotiana tabacum squalene synthase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS110G07- CTTGAACAAGAGTCCCTACAAGTCTTTAATATTATTT
                      ____________________________________________________________
consensus CTTGAACAAGAGTCCCTACAAGTCTTTAATATTATTT
 
. : . : . : . : . : . :
JMFS110G07- CAAGCCTCTTCAAAGTTTTGGAAGCAGTTGGGTCATTGTGGTCAACCTTTGATGATTATG
                      ____________________________________________________________
consensus CAAGCCTCTTCAAAGTTTTGGAAGCAGTTGGGTCATTGTGGTCAACCTTTGATGATTATG
 
. : . : . : . : . : . :
JMFS110G07- ATGAATATTGTCATTATGTTGCTGGGCTTGTTGGATTAGGCTTGTCAAAACTTTTTCATG
rJMSF052J06+ TTTTTCATG
                      ____________________________________________________________
consensus ATGAATATTGTCATTATGTTGCTGGGCTTGTTGGATTAGGCTTGTCAAAACTTTTTCATG
 
. : . : . : . : . : . :
JMFS110G07- CCTCTGGGACAGAGGATTTAGCTTCAGATTCTCTCTCGAATTCTATGGGTCTGTTCCTTC
rJMSF052J06+ CCTCTGGGACAGAGGATTTAGCTTCAGATTCTCTCTCGAATTCTATGGGTCTGTTCCTTC
                      ____________________________________________________________
consensus CCTCTGGGACAGAGGATTTAGCTTCAGATTCTCTCTCGAATTCTATGGGTCTGTTCCTTC
 
. : . : . : . : . : . :
JMFS110G07- AGAAAACAAACATTATTAGGGATTATCTGGAGGATATTAATGAGATACCAAA-GTGTCGG
rJMSF052J06+ AGAAAACAAACATTATTAGGGATTATCTGGAGGATATTAATGAGATACCAAA-GTGTCGG
rJMSF022L18+ GAGGATATTAATGAGATACCAAA-GTGTCGG
rJMSF020A01+ AGGATATTAATGAGATACCAAAGGGGTCGG
rJMFF040O18+ GATATTAATGAGATACCAAA-GTGTCGG
rJMFF006P12+ TATTAATGAGATACCAAA-GTGTCGG
                      ____________________________________________________________
consensus AGAAAACAAACATTATTAGGGATTATCTGGAGGATATTAATGAGATACCAAA-GTGTCGG
 
. : . : . : . : . : . :
JMFS110G07- ATGTTTTGGCCCCGGCAAATTTGGAGTAAATATGTCAACAAACTTGAGGAGTTGAAATAT
rJMSF052J06+ ATGTTTTGGCCCCGGCAAATTTGGAGTAAATATGTCAACAAACTTGAGGAGTTGAAATAT
rJMSF022L18+ ATGTTTTGGCCCCGGCAAATTTGGAGTAAATATGTCAACAAACTTGAGGAGTTGAAATAT
rJMSF020A01+ ATGTTTGGGCCCCGGCAAATTTGGAGTAAATATGTCAACAAACTTGAGGAGTTGAAATAT
rJMFF005D19+ ATGTTTTGGCCCCGGCAAATTTGGAGTAAATATGTCANCAAACTTGAGGAGTTGAAATAT
rJMFF040O18+ ATGTTTTGGCCCCGGCAAATTTGGAGTAAATATGTCAACAAACTTGAGGAGTTGAAATAT
rJMFF006P12+ ATGTTTTGNCCCCGGCAAATTTGGAGTAAATATGTCAACAAACTTGAGGAGTTGAAATAT
rJMFF036J16+ GAGTTGAAATAT
rJMSF023L18+ CGGCAAATTTGGAGTAAATATGTCAACAAACTTGAGGAGTTGAAATAT
rJMSF046I02+ GGCCCCGGCAAATTTGGAGTAAATATGTCAACAAACTTGAGGAGTTGAAATAT
rJMFF006J06+ GGCCCCGGCAAATTTGGAGTAAATATGTCAACAAACTTGAGGAGTTGAAATAT
                      ____________________________________________________________
consensus ATGTTTTGGCCCCGGCAAATTTGGAGTAAATATGTCAACAAACTTGAGGAGTTGAAATAT
 
. : . : . : . : . : . :
JMFS110G07- GAGGAGAACTCAGTGAATGCAGTACAATGTCTGAATGATATGGTCACAGATGCTTTATCA
rJMSF052J06+ GAGGAGAACTCAGTGAATGCAGTACAATGTCTGAATGATATGGTCACAGATGCTTTATCA
rJMSF022L18+ GAGGAGAACTCAGTGAATGCAGTACAATGTCTGAATGATATGGTCACAGATGCTTTATCA
rJMSF020A01+ GAGGAGAACTCAGTGAATGCAGTACAATGTCTGAATGATATGGTCACAGATGCTTTATCA
rJMFF036F03+ TGAATGCAGTACAATGTCTGAATGATATGGTCACAGATGCTTTATCA
rJMFF005D19+ GAGGAGAACTCAGTGAATGCAGTACAATGTCTGAATGATATGGTCACAGATGCTTTATCA
rJMFF040O18+ GAGGAGAACTCAGTGAATGCAGTACAATGTCTGAATGATATGGTCACAGATGCTTTATCA
rJMFF006P12+ GAGGAGAACTCAGTGAATGCAGTACAATGTCTGAATGATATGGTCACAGATGCTTTATCA
rJMFF036J16+ GAGGAGAACTCAGTGAATGCAGTACAATGTCTGAATGATATGGTCACAGATGCTTTATCA
rJMSF023L18+ GAGGAGAACTCAGTGAATGCAGTACAATGTCTGAATGATATGGTCACAGATGCTTTATCA
rJMSF046I02+ GAGGAGAACTCAGTGAATGCAGTACAATGTCTGAATGATATGGTCACAGATGCTTTATCA
rJMFF006J06+ GAGGAGAACTCAGTGAATGCAGTACAATGTCTGAATGATATGGTCACAGATGCTTTATCA
                      ____________________________________________________________
consensus GAGGAGAACTCAGTGAATGCAGTACAATGTCTGAATGATATGGTCACAGATGCTTTATCA
 
. : . : . : . : . : . :
JMFS110G07- CATGTAGAAGACTGTTTGACTTACATGTCTGCTCTACGAGATCCTTCTATCTTTAGGTTC
rJMSF052J06+ CATGTAGAAGACTGTTTGACTTACATGTCTGCTCTACGAGATCCTTCTATCTTTAGGTTC
rJMSF022L18+ CATGTAGAAGACTGTTTGACTTACATGTCTGCTCTACGAGATCCTTCTATCTTTAGGTTC
rJMSF020A01+ CATGTAGAAGACTGTTTGACTTACATGTCTGCTCTACGAGATCCTTCTATCTTTAGGTTC
rJMFF036F03+ CATGTAGAAGACTGTTTGACTTACATGTCTGCTCTACGAGATCCTTCTATCTTTAGGTTC
rJMFF005D19+ CATGTAGAAGACTGTTTGACTTACATGTCTGCTCTACGAGATCCTTCTATCTTTAGGTTC
rJMFF040O18+ CATGTAGAAGACTGTTTGACTTACATGTCTGCTCTACGAGATCCTTCTATCTTTAGGTTC
rJMFF006P12+ CATGTAGAAGACTGTTTGACTTACATGTCTGCTCTACGAGATCCTTCTATCTTTAGGTTC
rJMFF036J16+ CATGTAGAAGACTGTTTGACTTACATGTCTGCTCTACGAGATCCTTCTATCTTTAGGTTC
rJMSF023L18+ CATGTAGAAGACTGTTTGACTTACATGTCTGCTCTACGAGATCCTTCTATCTTTAGGTTC
rJMSF046I02+ CATGTAGAAGACTGTTTGACTTACATGTCTGCTCTACGAGATCCTTCTATCTTTAGGTTC
rJMFF006J06+ CATGTAGAAGACTGTTTGACTTACATGTCTGCTCTACGAGATCCTTCTATCTTTAGGTTC
                      ____________________________________________________________
consensus CATGTAGAAGACTGTTTGACTTACATGTCTGCTCTACGAGATCCTTCTATCTTTAGGTTC
 
. : . : . : . : . : . :
JMFS110G07- TGCGCTATTCCACAGATCATGGCGATTGGGACATTAGCCATGTGCTACAACAACATTGGA
rJMSF052J06+ TGCGCTATTCCACAGATCATGGCGATTGGGACATTAGCCATGTGCTACAACAACATTGGA
rJMSF022L18+ TGCGCTATTCCACAGATCATGGCGATTGGGACATTAGCCATGTGCTACAACAACATTGGA
rJMSF020A01+ TGCGCTATTCCACAGATCATGGCGATTGGGACATTAGCCATGTGCTACAACAACATTGGA
rJMFF036F03+ TGCGCTATTCCACAGATCATGGCGATTGGGACATTAGCCATGTGCTACAACAACATTGGA
rJMFF005D19+ TGCGCTATTCCACAGATCATGGCGATTGGGACATTAGCCATGTGCTACAACAACATTGGA
rJMFF040O18+ TGCGCTATTCCACAGATCATGGCGATTGGGACATTAGCCATGTGCTACAACAACATTGGA
rJMFF006P12+ TGCGCTATTCCACAGATCATGGCGATTGGGACATTAGCCATGTGCTACAACAACATTGGA
rJMFF036J16+ TGCGCTATTCCACAGATCATGGCGATTGGGACATTAGCCATGTGCTACAACAACATTGGA
rJMSF023L18+ TGCGCTATTCCACAGATCATGGCGATTGGGACATTAGCCATGTGCTACAACAACATTGGA
rJMSF046I02+ TGCGCTATTCCACAGATCATGGCGATTGGGACATTAGCCATGTGCTACAACAACATTGGA
rJMFF006J06+ TGCGCTATTCCACAGATCATGGCGATTGGGACATTAGCCATGTGCTACAACAACATTGGA
                      ____________________________________________________________
consensus TGCGCTATTCCACAGATCATGGCGATTGGGACATTAGCCATGTGCTACAACAACATTGGA
 
. : . : . : . : . : . :
JMFS110G07- GTCTTCAGGGGTGTTGTAAAGATGAGACTTGGTCTTACTGCTAAGGTTATTGACCGGACT
rJMSF052J06+ GTCTTCAGGGGTGTTGTAAAGATGAGACGTGGTCTTACTGCTAAGGTTATTGACCGGACT
rJMSF022L18+ GTCTTCAGGGGTGTTGTAAAGATGAGACGTGGTCTTACTGCTAAGGTTATTGACCGGACT
rJMSF020A01+ GTCTTCAGGGGTGTTGTAAAGATGAGACGTGGTCTTACTGCTAAGGTTATTGACCGGACT
rJMFF036F03+ GTCTTCAGGGGTGTTGTAAAGATGAGACGTGGTCTTACTGCTAAGGTTATTGACCGGACT
rJMFF005D19+ GTCTTCAGGGGTGTTGTAAAGATGAGACGTGGTCTTACTGCTAAGGTTATTGACCGGACT
rJMFF040O18+ GTCTTCAGGGGTGTTGTAAAGATGAGACGTGGTCTTACTGCTAAGGTTATTGACCGGACT
rJMFF006P12+ GTCTTCAGGGGTGTTGTAAAGATGAGACGTGGTCTTACTGCTAAGGTTATTGACCGGACT
rJMFF036J16+ GTCTTCAGGGGTGTTGTAAAGATGAGACGTGGTCTTACTGCTAAGGTTATTGACCGGACT
rJMSF023L18+ GTCTTCAGGGGTGTTGTAAAGATGAGACGTGGTCTTACTGCTAAGGTTATTGACCGGACT
rJMSF046I02+ GTCTTCAGGGGTGTTGTAAAGATGAGACGTGGTCTTACTGCTAAGGTTATTGACCGGACT
rJMFF006J06+ GTCTTCAGGGGTGTTGTAAAGATGAGACGTGGTCTTACTGCTAAGGTTATTGACCGGACT
                      ____________________________________________________________
consensus GTCTTCAGGGGTGTTGTAAAGATGAGACGTGGTCTTACTGCTAAGGTTATTGACCGGACT
 
. : . : . : . : . : . :
JMFS110G07- TGGACCATGGTAGATGTCTATGGATGGTCTTTTTGATTTTT
rJMSF052J06+ AGGACAATGGAAGATGTCTATGG-TGGTTTTTTTGATTTTTCTTGCATGCTAAAATCAAA
rJMSF022L18+ AGGACAATGGAAGATGTCTATGG-TGGTTTTTTTGATTTTTCTTGCATGCTAAAATCAAA
rJMSF020A01+ AGGACAATGGAAGATGTCTATGG-TGGTTTTTTTGATTTTTCTTGCATGCTAAAATCAAA
rJMFF036F03+ AGGACAATGGAAGATGTCTATGG-TGGTTTTTTTGATTTTTCTTGCATGCTAAAATCAAA
rJMFF005D19+ AGGACAATGGAAGATGTCTATGG-TGGTTTTTTTGATTTTTCTTGCATGCTAAAATCAAA
rJMFF040O18+ AGGACAATGGAAGATGTCTATGG-TGGTTTTTTTGATTTTTCTTGCATGCTAAAATCAAA
rJMFF006P12+ AGGACAATGGAAGATGTCTATGG-TGGTTTTTTTGATTTTTCTTGCATGCTAAAATCAAA
rJMFF036J16+ AGGACAATGGAAGATGTCTATGG-TGGTTTTTTTGATTTTTCTTGCATGCTAAAATCAAA
rJMSF023L18+ AGGACAATGGAAGATGTCTATGG-TGGTTTTTTTGATTNTTCNNGCATNCTAAAATCAAA
rJMSF046I02+ AGGACAATGGAAGATGTCTATGG-TGGTTTTTTTGATTTTTCTTGCATGCTAAAATCAAA
rJMFF006J06+ AGGACAATGGAAGATGTCTATGG-TGGTTTTTTTGATTTTTCTTGCATGCTAAAATCAAA
                      ____________________________________________________________
consensus AGGACAATGGAAGATGTCTATGG-TGGTTTTTTTGATTTTTCTTGCATGCTAAAATCAAA
 
. : . : . : . : . : . :
rJMSF052J06+ GGTTGACCACAATGACCCAACTGCTTCCAAAACTTTGAAGAGGCTTGAAATAATATTAAA
rJMSF022L18+ GGTTGACCACAATGACCCAACTGCTTCCAAAACTTTGAAGAGGCTTGAAATAATATTAAA
rJMSF020A01+ GGTTGACCACAATGACCCAACTGCTTCCAAAACTTTGAAGAGGCTTGAAATAATATTAAA
rJMFF036F03+ GGTTGACCACAATGACCCAACTGCTTCCAAAACTTTGAAGAGGCTTGAAATAATATTAAA
rJMFF005D19+ GGTTGACCACAATGACCCAACTGCTTCCAAAACTTTGAAGAGGCTTGAAATAATATTAAA
rJMFF040O18+ GGTTGACCACAATGACCCAACTGCTTCCAAAACTTTGAAGAGGCTTGAAATAATATTAAA
rJMFF006P12+ GGTTGACCACAATGACCCAACTGCTTCCAAAACTTTGAAGAGGCTTGAAATAATATTAAA
rJMFF036J16+ GGTTGACCACAATGACCCAACTGCTTCCAAAACTTTGAAGAGGCTTGAAATAATATTAAA
rJMSF023L18+ GGTTGACCACAATGACCCANCTGCTTCCAAAACTTTGAAGAGGCNTGAAATAATATTAAA
rJMSF046I02+ GGTTGACCACAATGACCCAACTGCTTCCAAAACTTTGAAGAGGCTTGAAATAATATTAAA
rJMFF006J06+ GGTTGACCACAATGACCCAACTGCTTCCAAAACTTTGAAGAGGCTTGAAATAATATTAAA
                      ____________________________________________________________
consensus GGTTGACCACAATGACCCAACTGCTTCCAAAACTTTGAAGAGGCTTGAAATAATATTAAA
 
. : . : . : . : . : . :
rJMSF052J06+ GACTTGTAGGGACTCTGGGACCTTGAACAAGAGGAAATCTTACATTTTGAGGGCTGAGCC
rJMSF022L18+ GACTTGTAGGGACTCTGGGACCTTGAACAAGAGGAAATCTTACATTTTGAGGGCTGAGCC
rJMSF020A01+ GACTTGTAGGGACTCTGGGACCTTGAACAAGAGGAAATCTTACATTTTGAGGGCTGAGCC
rJMFF036F03+ GACTTGTAGGGACTCTGGGACCTTGAACAAGAGGAAATCTTACATTTTGAGGGCTGAGCC
rJMFF005D19+ GACTTGTAGGGACTCTGGGACCTTGAACAAGAGGAAATCTTACATTTTGAGGGCTGAGCC
rJMFF040O18+ GACTTGTAGGGACTCTGGGACCTTGAACAAGAGGAAATCTTACATTTTGAGGGCTGAGCC
rJMFF006P12+ GACTTGTAGGGACTCTGGGACCTTGAACAAGAGGAAATCTTACATTTTGAGGGCTGAGCC
rJMFF036J16+ GACTTGTAGGGACTCTGGGACCTTGAACAAGAGGAAATCTTACATTTTGAGGGCTGAGCC
rJMSF023L18+ GACTTGTAGGGACTCTGGGACCTTGAACAAGAGGAAATCTTACATTTNGAGGGCTGNGCC
rJMSF046I02+ GACTTGTAGGGACTCTGGGACCTTGAACAAGAGGAAATCTTACATTTTGAGGGCTGAGCC
rJMFF006J06+ GACTTGTAGGGACTCTGGGACCTTGAACAAGAGGAAATCTTACATTTTGAGGGCTGAGCC
                      ____________________________________________________________
consensus GACTTGTAGGGACTCTGGGACCTTGAACAAGAGGAAATCTTACATTTTGAGGGCTGAGCC
 
. : . : . : . : . : . :
rJMSF052J06+ TAATTATACTCCTGCTCTGATCATTGTCTTCTTTATCATTCTGGCTATTCTTCTTGGATA
rJMSF022L18+ TAATTATACTCCTGCTCTGATCATTGTCTTCTTTATCATTCTGGCTATTCTTCTTGGATA
rJMSF020A01+ TAATTATACTCCTGCTCTGATCATTGTCTTCTTTATCATTCTGGCTATTCTTCTTGGATA
rJMFF036F03+ TAATTATACTCCTGCTCTGATCATTGTCTTCTTTATCATTCTGGCTATTCTTCTTGGATA
rJMFF005D19+ TAATTATACTCCTGCTCTGATCATTGTCTTCTTTATCATTCTGGCTATTCTTCTTGGATA
rJMFF040O18+ TAATTATACTCCTGCTCTGATCATTGTCTTCTTTATCATTCTGGCTATTCTTCTTGGATA
rJMFF006P12+ TAATTATACTCCTGCTCTGATCATTGTCTTCTTTATCATTCTGGCTATTCTTCTTGGATA
rJMFF036J16+ TAATTATACTCCTGCTCTGATCATTGTCTTCTTTATCATTCTGGCTATTCTTCTTGGATA
rJMSF023L18+ TAATTATACTCCTGCTCTGATCATTGTCTTCTTTATCANTCTGGCTATTCTTCTTGGATA
rJMSF046I02+ TAATTATACTCCTGCTCTGATCATTGTCTTCTTTATCATTCTGGCTATTCTTCTTGGATA
rJMFF006J06+ TAATTATACTCCTGCTCTGATCATTGTCTTCTTTATCATTCTGGCTATTCTTCTTGGATA
                      ____________________________________________________________
consensus TAATTATACTCCTGCTCTGATCATTGTCTTCTTTATCATTCTGGCTATTCTTCTTGGATA
 
. : . : . : . : . : . :
rJMSF052J06+ TCTTTCTGGGAACAAACCTCATTCTGTGTGATTGGTTACCATTAGTAGTTAAAAAGAAGT
rJMSF022L18+ TCTTTCTGGGAACAAACCTCATTCTGTGTGATTGGTTACCATTAGTAGTTAAAAAGAAGT
rJMSF020A01+ TCTTTCTGGGAACAAACCTCATTCTGTGTGATTGGTTACCATTAGTAGTTAAAAAGAAGT
rJMFF036F03+ TCTTTCTGGGAACAAACCTCATTCTGTGTGATTGGTTACCATTAGTAGTTAAAAAGAAGT
rJMFF005D19+ TCTTTCTGGGAACAAACCTCATTCTGTGTGATTGGTTACCATTAGTAGTTAAAAAGAAGT
rJMFF040O18+ TCTTTCTGGGAACAAACCTCATTCTGTGTGATTGGTTACCATTAGTAGTTAAAAAGAAGT
rJMFF006P12+ TCTTTCTGGGAACAAACCTCATTCTGTGTGATTGGTTACCATTAGTAGTTAAAAAGAAGT
rJMFF036J16+ TCTTTCTGGGAACAAACCTCATTCTGTGTGATTGGTTACCATTAGTAGTTAAAAAGAAGT
rJMSF023L18+ TCTTTCTGGGAACAAACCTCATTCNGTGTGATTGGTTACCATTAGTAGNTAAAAAGAAGT
rJMSF046I02+ TCTTTCTGGGAACAAACCTCATTCTGTGTGATTGGTTACCATTAGTAGTTAAAAAGAAGT
rJMFF006J06+ TCTTTCTGGGAACAAACCTCATTCTGTGTGATTGGTTACCATTAGTAGTTAAAAAGAAGT
                      ____________________________________________________________
consensus TCTTTCTGGGAACAAACCTCATTCTGTGTGATTGGTTACCATTAGTAGTTAAAAAGAAGT
 
. : . : . : . : . : . :
rJMSF052J06+ TTGTCCAAGAAGAAAAACTTAATGACCCAC-AACATTGGCTCTCGTCTTTAAGGTATTA-
rJMSF022L18+ TTGTCCAAGAAGAAAAACTTAATGACCCAC-AACATTGGCTCTCGTCTTTAAGGTATTA-
rJMSF020A01+ TTGTCCAAGAAGAAAAACTTAATGACCCAC-AACATTGGCTCTCGTCTTTAAGGTATTA-
rJMFF036F03+ TTGTCCAAGAAGAAAAACTTAATGACCCAC-AACATTGGCTCTCGTCTTTAAGGTATTA-
rJMFF005D19+ TTGTCCAAGAAGAAAAACTTAATGACCCAC-AACATTGGCTCTCGTCTTTAAGGTATTA-
rJMFF040O18+ TTGTCCAAGAAGAAAAACTTAATGACCCAC-AACATTGGCTCTCGTCTTTAAGGTATTA-
rJMFF006P12+ TTGTCCAAGAAGAAAAACTTAATGACCCAC-AACATTGGCTCTCGTCTTTAAGGTATTA-
rJMFF036J16+ TTGTCCAAGAAGAAAAACTTAATGACCCAC-AACATTGGCTCTCGTCTTTAAGGTATTA-
rJMSF023L18+ TTGTCCAAGAAGAAAAACTTAATGACCCAC-AACATTGGCTCTCGTCTNTAAGGTATTAC
rJMSF046I02+ TTGTCCAAGAAGAAAAACTTAATGACCCACAAACATTGGCTCTCGTCTTTAAGGTATTA-
rJMFF006J06+ TTGTCCAAGAAGAAAAACTTAATGACCCAC-AACATTGGCTCTCGTCTTTAAGGTATTA-
                      ____________________________________________________________
consensus TTGTCCAAGAAGAAAAACTTAATGACCCAC-AACATTGGCTCTCGTCTTTAAGGTATTA-
 
. : . : . : . : . : . :
rJMSF052J06+ TGA
rJMSF022L18+ TGA-TGATGTTGTCTACATATATGCTTAATGGTGATGTTAGCACTCTATTAATCAACAAC
rJMSF020A01+ TGA-TGATGTTGTCTACATATATGCTTAATGGTGATGTTAGCACTCTATTAATCAACAAC
rJMFF036F03+ TGA-TGA
rJMFF005D19+ TGA-TGAT
rJMFF040O18+ TGA-TGATGTTGTCTACATATATGCTTAATGGTGATGTTAGCACTCTATTAATCAACAAC
rJMFF006P12+ TGA-TGATGTTGTCTACATATATGCTTAATGGTGATGTTAGCACTCTATTAATCAACAAC
rJMFF036J16+ TGA-TGATGTTGTCTACATATATGCTTAATGGTGATGTTAGCACTCTATTAATCAACAAC
rJMSF023L18+ TGACTGATGTTGNCTACATATATNCTTAATGGTGATGTTAGCACTCTATTAATCAACAAC
rJMSF046I02+ TGA-TGA
rJMFF006J06+ TGA-TGATGTTGTCTACATATATGCTTAATGGTGATGTTAGCACTCTATTAATCAACAAC
                      ____________________________________________________________
consensus TGA-TGATGTTGTCTACATATATGCTTAATGGTGATGTTAGCACTCTATTAATCAACAAC
 
. : . : . : . : . : . :
rJMSF022L18+ TGTTTGCGATTTGGCTGTCAATTTATTGTCTGTGGGGGAAATGA
rJMSF020A01+ TGTTTGCGATTTGGCTGTCAATTTATNGTCTGTGGGGGAAATGAA
rJMFF040O18+ TGTTTGCGATTTGGCTGTCAATTTATTGTCTGTGGGGGAAATGAAGGTGTATCG
rJMFF006P12+ TGTTTGCGATTTGGCTGTCAATTTATTGTCTGTGGGGGAAATGAAGGTGTATCG
rJMFF036J16+ TGTTTGCGATTTGGCTGTCAATTTATTGTCTGTGGGGGAAATGAAGGTGTATCG
rJMSF023L18+ TGTTTGCGATTNGGCTGTCAATTTATTGTCTGTGGGNGAAATGAAGG
rJMFF006J06+ TGTTTGCGATTTGGCTGTCAATTTATTGTCTGTGGGGGAAATGAAGGTGTATCGGCTTAG
                      ____________________________________________________________
consensus TGTTTGCGATTTGGCTGTCAATTTATTGTCTGTGGGGGAAATGAAGGTGTATCGGCTTAG