Previous Contig 008437:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006H04Sequence574000323 (3)pir|T10232|T102329e-11hypothetical protein T11I11.100 - Arabidopsis thaliana>gb:ATCHRIV82_1547447 Arab645008437 (3)pir|T10232|T102321e-83hypothetical protein T11I11.100 - Arabidopsis thaliana>gb:ATCHRIV82_1547447 Arab
JMFF036G17Sequence573000323 (3)pir|T10232|T102329e-11hypothetical protein T11I11.100 - Arabidopsis thaliana>gb:ATCHRIV82_1547447 Arab743008437 (3)gb:AJ717412_1813796e-103Lotus corniculatus var. japonicus mRNA for putative neutral/alkaline invertase (
JMSF015E18Sequence448000323 (3)pir|T10232|T102321e-15hypothetical protein T11I11.100 - Arabidopsis thaliana>gb:ATCHRIV82_1547447 Arab778008437 (3)gb:AJ717412_1813796e-112Lotus corniculatus var. japonicus mRNA for putative neutral/alkaline invertase (

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF015E18+ GTATTCGCACA
                      ____________________________________________________________
consensus GTATTCGCACA
 
. : . : . : . : . : . :
rJMSF015E18+ CAGCAGTAAACAAGTTTAACGTGATGCCAGACTCTCTTCCAGATTGGGTGTTTGATTTCA
rJMFF036G17+ CTTCCAGATTGGGTGTTTGATTTCA
                      ____________________________________________________________
consensus CAGCAGTAAACAAGTTTAACGTGATGCCAGACTCTCTTCCAGATTGGGTGTTTGATTTCA
 
. : . : . : . : . : . :
rJMSF015E18+ TGCCAACTCGAGGGGGATACTTCATTGGGAACGTAAGTCCAGCTAGAATGGACTTCCGTT
rJMFF036G17+ TGCCAACTCGAGGGGGATACTTCATTGGGAACGTAAGTCCAGCTAGAATGGACTTCCGTT
                      ____________________________________________________________
consensus TGCCAACTCGAGGGGGATACTTCATTGGGAACGTAAGTCCAGCTAGAATGGACTTCCGTT
 
. : . : . : . : . : . :
rJMSF015E18+ GGTTTTGCTTGGGCAACTGCATCGCAATCTTGTCGTGTTTGGCTACACCCGAGCAAGCCT
rJMFF036G17+ GGTTTTGCTTGGGCAACTGCATCGCAATCTTGTCGTGTTTGGCTACACCCGAGCAAGCCT
rJMFF006H04+ AACTGCATCGCAATCTTGTCGTGTTTGGCTACACCCGAGCAAGCCT
                      ____________________________________________________________
consensus GGTTTTGCTTGGGCAACTGCATCGCAATCTTGTCGTGTTTGGCTACACCCGAGCAAGCCT
 
. : . : . : . : . : . :
rJMSF015E18+ CGGCCATAATGGATCTCATTGAATCCCGATGGGAAGAGCTAGTCGGGGAAATGCCTCTAA
rJMFF036G17+ CGGCCATAATGGATCTCATTGAATCCCGATGGGAAGAGCTAGTCGGGGAAATGCCTCTAA
rJMFF006H04+ CGGCCATAATGGATCTCATTGAATCCCGATGGGAAGAGCTAGTCGGGGAAATGCCTCTAA
                      ____________________________________________________________
consensus CGGCCATAATGGATCTCATTGAATCCCGATGGGAAGAGCTAGTCGGGGAAATGCCTCTAA
 
. : . : . : . : . : . :
rJMSF015E18+ AGATCTGTTATCCAGCCATGGAAGGTCACGAGTGGAGAATTGTCACGGGATGTGATCCAA
rJMFF036G17+ AGATCTGTTATCCAGCCATGGAAGGTCACGAGTGGAGAATTGTCACGGGATGTGATCCAA
rJMFF006H04+ AGATCTGTTATCCAGCCATGGAAGGTCACGAGTGGAGAATTGTCACGGGATGTGATCCAA
                      ____________________________________________________________
consensus AGATCTGTTATCCAGCCATGGAAGGTCACGAGTGGAGAATTGTCACGGGATGTGATCCAA
 
. : . : . : . : . : . :
rJMSF015E18+ AGAACACCAGCTGGAGTTACCACAATGGTGGATCTTGGCCAGTCCTGCTATGGCTTCTCA
rJMFF036G17+ AGAACACCAGCTGGAGTTACCACAATGGTGGATCTTGGCCAGTCCTGCTATGGCTTCTCA
rJMFF006H04+ AGAACACCAGCTGGAGTTACCACAATGGTGGATCTTGGCCAGTCCTGCTATGGCTTCTCA
                      ____________________________________________________________
consensus AGAACACCAGCTGGAGTTACCACAATGGTGGATCTTGGCCAGTCCTGCTATGGCTTCTCA
 
. : . : . : . : . : . :
rJMSF015E18+ CAGCAGCCTGCATCAAGACGGGACGACCCCAAATCGCGAGAAAGGCCATTGAGCTGGCCG
rJMFF036G17+ CAGCAGCCTGCATCAAGACGGGACGACCCCAAATCGCGAGAAAGGCCATTGAGCTGGCCG
rJMFF006H04+ CAGCAGCCTGCATCAAGACGGGACGACCCCAAATCGCGAGAAAGGCCATTGAGCTGGCCG
                      ____________________________________________________________
consensus CAGCAGCCTGCATCAAGACGGGACGACCCCAAATCGCGAGAAAGGCCATTGAGCTGGCCG
 
. : . : . : . : . : . :
rJMSF015E18+ AAGCTCGCCTTTTGAAGGACAACTGGCCTGAATATTACGACGGGAAACATGGGCGCTACA
rJMFF036G17+ AAGCTCGCCTTTTGAAGGACAACTGGCCTGAATATTACGACGGGAAACATGGGCGCTACA
rJMFF006H04+ AAGCTCGCCTTTTGAAGGACAACTGGCCTGAATATTACGACGGGAAACATGGGCGCTACA
                      ____________________________________________________________
consensus AAGCTCGCCTTTTGAAGGACAACTGGCCTGAATATTACGACGGGAAACATGGGCGCTACA
 
. : . : . : . : . : . :
rJMSF015E18+ TCGGGAAACAGGTCCGGAAGTGCCAGACGTGGTCGATTGCAGGTTACTTGGTGGCAAGGA
rJMFF036G17+ TCGGGAAACAGGCCCGGAAGTGCCAGACGTGGTCGATTGCAGGTTACTTGGTGGCAAGGA
rJMFF006H04+ TCGGGAAACAGGCCCGGAAGTGCCAGACGTGGTCGATTGCAGGTTACTTGGTGGCAAGGA
                      ____________________________________________________________
consensus TCGGGAAACAGGCCCGGAAGTGCCAGACGTGGTCGATTGCAGGTTACTTGGTGGCAAGGA
 
. : . : . : . : . : . :
rJMSF015E18+ TGATGCTTGAAGATCCATCTCACATAGGTATGATTGCTCTTGAGGAAGACAAGCAGATGC
rJMFF036G17+ TGATGCTTGAAGATCCATCTCACATAGGTATGATTGCTCTTGAGGAAGACAAGCAGATGC
rJMFF006H04+ TGATGCTTGAAGATCCATCTCACATAGGTATGATTGCTCTTGAGGAAGACAAGCAGATGC
                      ____________________________________________________________
consensus TGATGCTTGAAGATCCATCTCACATAGGTATGATTGCTCTTGAGGAAGACAAGCAGATGC
 
. : . : . : . : . : . :
rJMSF015E18+ TGCCTCAGATGAAAAGATCTTCTTCATGGATGTTTTGATGTTTACTTTGTCACACATATA
rJMFF036G17+ TGCCTCAGATGAAAAGATCTTCTTCATGGATGTTTTGATGTTTACTTTGTCACACATATA
rJMFF006H04+ TGCCTCAGATGAAAAGATCTTCTTCATGGATGTTTTGATGTTTACTTTGTCACACATATA
                      ____________________________________________________________
consensus TGCCTCAGATGAAAAGATCTTCTTCATGGATGTTTTGATGTTTACTTTGTCACACATATA
 
. : . : . : . : . : . :
rJMSF015E18+ CCTATACTTTATCTACAGACACACTACACATCCTTAATGTACATTTTATTGTCTTTTTTT
rJMFF036G17+ CCTATACTTTATCTACAGACACACTACACATCCTTAATGTACATTTTATTGTCTTTTTTT
rJMFF006H04+ CCTATACTTTATCTACAGACACACTACACATCCTTAATGTACATTTTATTGTCTTTTTTT
                      ____________________________________________________________
consensus CCTATACTTTATCTACAGACACACTACACATCCTTAATGTACATTTTATTGTCTTTTTTT
 
. : . : . : . : . : . :
rJMSF015E18+ AAAACAACCACGGCTATCGAACCAATGGTGTATGTTGCTCATTGAGA
rJMFF036G17+ AAAACAACCACGGCTATCGAA-CAATGGTGTATGTTGCTCATTGAGACAAGAGTTCATA
rJMFF006H04+ AAAACAACCACGGCTATCGAA-CAATGGTGTATGTTGCTCATTGAGACAAGAGTTCATAA
                      ____________________________________________________________
consensus AAAACAACCACGGCTATCGAA-CAATGGTGTATGTTGCTCATTGAGACAAGAGTTCATAA