Previous Contig 008434:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006G11Sequence567007544 (2)gb:AY045648_15612393e-56Arabidopsis thaliana At2g14841 mRNA, complete cds.>gb:AY058239_1564364 Arabidops618008434 (2)gb:AY088041_15730658e-41Arabidopsis thaliana clone 40603 mRNA, complete sequence.
JMSF043F03Sequence762007544 (2)gb:AY045648_15612395e-55Arabidopsis thaliana At2g14841 mRNA, complete cds.>gb:AY058239_1564364 Arabidops732008434 (2)gb:AY088041_15730651e-45Arabidopsis thaliana clone 40603 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF043F03+ CTGCTGGAAAAGATTTGAAGGATATACAGCTGTCCCTGCAACAGGTTCTGC
                      ____________________________________________________________
consensus CTGCTGGAAAAGATTTGAAGGATATACAGCTGTCCCTGCAACAGGTTCTGC
 
. : . : . : . : . : . :
rJMSF043F03+ AAAACCTTCAGCCATTGATATTGTTGAAATAGATGGACTAAACTCAGCTTCAGCTCATTC
                      ____________________________________________________________
consensus AAAACCTTCAGCCATTGATATTGTTGAAATAGATGGACTAAACTCAGCTTCAGCTCATTC
 
. : . : . : . : . : . :
rJMSF043F03+ CAATCATGAGGCCAACTTTACTAAAAGCTCGAGTCCTCCTGCTCCAGGGGCTACCACACG
rJMFF006G11+ TCCAGGGGCTACCACACG
                      ____________________________________________________________
consensus CAATCATGAGGCCAACTTTACTAAAAGCTCGAGTCCTCCTGCTCCAGGGGCTACCACACG
 
. : . : . : . : . : . :
rJMSF043F03+ AAAGAGCGCAATACAAGTAGAAAGACAAAATTCTGAATTTTCATATTATGCTGATGACGA
rJMFF006G11+ AAAGAGCGCAATACAAGTAGAAAGACAAAATTNTGAAATTTCATATTATGCTGATGACGA
                      ____________________________________________________________
consensus AAAGAGCGCAATACAAGTAGAAAGACAAAATTCTGAATTTTCATATTATGCTGATGACGA
 
. : . : . : . : . : . :
rJMSF043F03+ AGATGGGAACCGGAAAAAGTACACTAAAAGGGGTACACTGCAACACAAGTTCCTTAGATC
rJMFF006G11+ AGATGGGAACCGGAAAAAGTACACTAAAAGGGGTACACTGCAACACAAGTTCCTTAGATC
                      ____________________________________________________________
consensus AGATGGGAACCGGAAAAAGTACACTAAAAGGGGTACACTGCAACACAAGTTCCTTAGATC
 
. : . : . : . : . : . :
rJMSF043F03+ TTTGCTGCCTTTTTGGTCAAGTGCATTACCAACACTACCTGTGACTGCACCACCACGGAA
rJMFF006G11+ TTTGCTGCCTTTTTGGTCAAGTGCATTACCAACACTACCTGTGACTGCACCACCACGGAA
                      ____________________________________________________________
consensus TTTGCTGCCTTTTTGGTCAAGTGCATTACCAACACTACCTGTGACTGCACCACCACGGAA
 
. : . : . : . : . : . :
rJMSF043F03+ AGAGGCACCAAATGCAGATGGCACACGCCATCATAGATCTTCAAGGATGGATCCAAGAAA
rJMFF006G11+ AGAGGCACCAAATGCAGATGGCACACGCCATCATAGATCTTCAAGGATGGATCCAAGAAA
                      ____________________________________________________________
consensus AGAGGCACCAAATGCAGATGGCACACGCCATCATAGATCTTCAAGGATGGATCCAAGAAA
 
. : . : . : . : . : . :
rJMSF043F03+ AATCCTCCTTGTTATAGCCATCATGGCTTGCATGGCAACGATGGGTATCTTGTATTATAG
rJMFF006G11+ AATCCTCCTTGTTATAGCCATCATGGCTTGCATGGCAACGATGGGTATCTTGTATTATAG
                      ____________________________________________________________
consensus AATCCTCCTTGTTATAGCCATCATGGCTTGCATGGCAACGATGGGTATCTTGTATTATAG
 
. : . : . : . : . : . :
rJMSF043F03+ ACTTGCACTAGGTCTGGAGGAGTTGCCTGATGAAAAGCAGCAGTAATGTTCAATACTCCT
rJMFF006G11+ ACTTGCACTAGGTCTGGAGGAGTTGCCTGATGAAAAGCAGCAGTAATGTTCAATACTCCT
                      ____________________________________________________________
consensus ACTTGCACTAGGTCTGGAGGAGTTGCCTGATGAAAAGCAGCAGTAATGTTCAATACTCCT
 
. : . : . : . : . : . :
rJMSF043F03+ GTTGCAGCTTGATTGATGGTGTACCACTTTAAGATCAAAGTAGCAACATTTTTCTCCTCC
rJMFF006G11+ GTTGCAGCTTGATTGATGGTGTACCACTTTAAGATCAAAGTAGCAACATTTTTCTCCTCC
                      ____________________________________________________________
consensus GTTGCAGCTTGATTGATGGTGTACCACTTTAAGATCAAAGTAGCAACATTTTTCTCCTCC
 
. : . : . : . : . : . :
rJMSF043F03+ CATTTGGGGTCAATTGGAATTTTCAGGACCAGTTTTGTATGGGAATGTGCAACTTGCAAT
rJMFF006G11+ CATTTGGGGTCAATTGGAATTTTCAGGACCAGTTTTGTATGGGAATGTGCAACTTGCAAT
                      ____________________________________________________________
consensus CATTTGGGGTCAATTGGAATTTTCAGGACCAGTTTTGTATGGGAATGTGCAACTTGCAAT
 
. : . : . : . : . : . :
rJMSF043F03+ ACTTGGTCTGTCAGTTACAGTCTTACAGAGAATACATGTAGCTGTGATTATTATGTTGCC
rJMFF006G11+ ACTTGGTCTGTCAGTTACAGTCTTACAGAGAATACATGTAGCTGTGATTATTATGTTGCC
                      ____________________________________________________________
consensus ACTTGGTCTGTCAGTTACAGTCTTACAGAGAATACATGTAGCTGTGATTATTATGTTGCC
 
. : . : . : . : . : . :
rJMSF043F03+ CATTCCTAGTTTTGGT
rJMFF006G11+ CATTCCTAGTTTTGGTTGCTTTAACCTTGACTTCAGAAGTATCAGTTAAAAAGGAAAACT
                      ____________________________________________________________
consensus CATTCCTAGTTTTGGTTGCTTTAACCTTGACTTCAGAAGTATCAGTTAAAAAGGAAAACT