Previous Contig 008432:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006G01Sequence466000317 (2)sp|Q9M0Y6|DPNM_ARATH8e-23Putative PAP-specific phosphatase, mitochondrial precursor (3'(2'),5'- bisphosph710008432 (2)sp|Q9M0Y6|DPNM_ARATH2e-58Putative PAP-specific phosphatase, mitochondrial precursor (3'(2'),5'- bisphosph
JMSF006P15Sequence207005125 (29)gb:AY647982_21458589e-21Yeast two-hybrid vector pDG2, complete sequence.340008432 (2)sp|Q9M0Y6|DPNM_ARATH2e-14Putative PAP-specific phosphatase, mitochondrial precursor (3'(2'),5'- bisphosph

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006G01+ CAGGAATCATAATGGTTTCTCATTTGGGATGTGGAACATGGAGAAAGAGGT
                      ____________________________________________________________
consensus CAGGAATCATAATGGTTTCTCATTTGGGATGTGGAACATGGAGAAAGAGGT
 
. : . : . : . : . : . :
rJMFF006G01+ TATGGAACACACAAAGTGGTGAATTGTCTAATAACTGGACCAGATGCTCTGTTGATGAGT
                      ____________________________________________________________
consensus TATGGAACACACAAAGTGGTGAATTGTCTAATAACTGGACCAGATGCTCTGTTGATGAGT
 
. : . : . : . : . : . :
rJMFF006G01+ GCCAATTAGTTCAGGATGCAAGCTTTTGCATTCCAGAGTCTCAAACATGGGAGTTAATAC
                      ____________________________________________________________
consensus GCCAATTAGTTCAGGATGCAAGCTTTTGCATTCCAGAGTCTCAAACATGGGAGTTAATAC
 
. : . : . : . : . : . :
rJMFF006G01+ CCCTATCAGCTTTATTCAATGCAAAAAATCAGGCTGAAAAAGTTGGAGACAGAGACATTC
                      ____________________________________________________________
consensus CCCTATCAGCTTTATTCAATGCAAAAAATCAGGCTGAAAAAGTTGGAGACAGAGACATTC
 
. : . : . : . : . : . :
rJMFF006G01+ TTCTTTTGTCTGCTTGCTGTGGAAGCTTGTGTAAATATTTGATGGTGGCTTCTGGAAGGG
                      ____________________________________________________________
consensus TTCTTTTGTCTGCTTGCTGTGGAAGCTTGTGTAAATATTTGATGGTGGCTTCTGGAAGGG
 
. : . : . : . : . : . :
rJMSF006P15+ G
rJMFF006G01+ CATCAGTTTTTATTATCCATGTGAAGACTGGAAAACTCATCAGGGCATGGGATCATGCTG
                      ____________________________________________________________
consensus CATCAGTTTTTATTATCCATGTGAAGACTGGAAAACTCATCAGGGCATGGGATCATGCTG
 
. : . : . : . : . : . :
rJMSF006P15+ TAGGAGTCATATGCATCCATGAAGCTGGTGGAAAGGNGAGTGACTGGAGAGGGAATGATA
rJMFF006G01+ TAGGAGTCATATGCATCCATGAAGCTGGTGGAAAGGTGAGTGACTGGAGAGGGAATGATA
                      ____________________________________________________________
consensus TAGGAGTCATATGCATCCATGAAGCTGGTGGAAAGGTGAGTGACTGGAGAGGGAATGATA
 
. : . : . : . : . : . :
rJMSF006P15+ TTGATTTTGCNGAAGATGAAGNTGAACGGAGACTCATATTTCCTTCCGGCGGCANTCTTG
rJMFF006G01+ TTGATTTTGCCGAAGATGAAGTTGAACGGAGACTCATATTTCCTTCCGGCGGCATTCTTG
                      ____________________________________________________________
consensus TTGATTTTGCCGAAGATGAAGTTGAACGGAGACTCATATTTCCTTCCGGCGGCATTCTTG
 
. : . : . : . : . : . :
rJMSF006P15+ TGACCAATCAAAGCTTACACAAGGATATATTAGGGATGATCTCTTCAAGTTCATCAGTGG
rJMFF006G01+ TGACCAATCAAAGCTTACACAAGGATATATTAGGGATGATCTCTTCAAGTTCATCAGTGG
                      ____________________________________________________________
consensus TGACCAATCAAAGCTTACACAAGGATATATTAGGGATGATCTCTTCAAGTTCATCAGTGG
 
. : . : . : . : . : . :
rJMSF006P15+ TTTATTAGTTCTGGGTANTCCTTCACCTCTCTCTTGCTCCTCAACTCATTATTGCCNGTC
rJMFF006G01+ TTTATTAGTTCTGGGTATTCCTTCACCTCTCTCTTGCTCCTCAACTCATTATTGCCTGTC
                      ____________________________________________________________
consensus TTTATTAGTTCTGGGTATTCCTTCACCTCTCTCTTGCTCCTCAACTCATTATTGCCTGTC
 
. : . : . : . : . : . :
rJMSF006P15+ ATTCAATATTCTGCACTATNTATTCTTCAAGCCTTGGTTTANTTAAAGTTCAGATTACAA
rJMFF006G01+ ATTCAATATTCTGCACTATCTATTCTTCAAGCCTTGGTTTATTTAAAGTTCAGATTA-AA
                      ____________________________________________________________
consensus ATTCAATATTCTGCACTATCTATTCTTCAAGCCTTGGTTTATTTAAAGTTCAGATTACAA
 
. : . : . : . : . : . :
rJMSF006P15+ TCCTCAAATTCTTGAACTGAATCAACTGATCCAGAAAAC
rJMFF006G01+ TCCTCAAATTCTTGAACTGAATCAACTGATACAGAAAACCATACTTCTGTCATAATAGTA
                      ____________________________________________________________
consensus TCCTCAAATTCTTGAACTGAATCAACTGATCCAGAAAACCATACTTCTGTCATAATAGTA