Previous Contig 008429:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006B17Sequence577008429 (27)gb:AY360221_16020411e-83Ricinus communis actin (ACT) mRNA, complete cds.768008429 (27)gb:AF548026_1810716e-100Stevia rebaudiana actin mRNA, complete cds.
JMFF006F14Sequence486008429 (27)gb:OSRAC1_16983222e-65Oryza sativa RAc1 mRNA for actin.753008429 (27)gb:AF548026_18107168e-55Stevia rebaudiana actin mRNA, complete cds.
JMFF007M16Sequence646008429 (27)gb:AY360221_16020413e-98Ricinus communis actin (ACT) mRNA, complete cds.783008429 (27)gb:AF548026_18107168e-88Stevia rebaudiana actin mRNA, complete cds.
JMFF014A06Sequence536008429 (27)gb:AY360221_16020414e-77Ricinus communis actin (ACT) mRNA, complete cds.826008429 (27)gb:AF548026_18107162e-88Stevia rebaudiana actin mRNA, complete cds.
JMFF015G01Sequence661008429 (27)gb:AY360221_1602041e-100Ricinus communis actin (ACT) mRNA, complete cds.670008429 (27)gb:AY372368_16032432e-83Trifolium pratense actin mRNA, complete cds.
JMFF016D15Sequence536008429 (27)gb:AY360221_16020411e-76Ricinus communis actin (ACT) mRNA, complete cds.757008429 (27)gb:AF548026_18107162e-94Stevia rebaudiana actin mRNA, complete cds.
JMFF021B22Sequence160008429 (27)
JMFF029M03Sequence425008429 (27)gb:OSRAC1_16983225e-53Oryza sativa RAc1 mRNA for actin.638008429 (27)pir|S20097|S200974e-82actin 85c - potato (fragment)
JMFF029P08Sequence478008429 (27)gb:OSRAC1_16983225e-65Oryza sativa RAc1 mRNA for actin.776008429 (27)gb:AF548026_18107161e-50Stevia rebaudiana actin mRNA, complete cds.
JMFF035N23Sequence514008429 (27)gb:OSRAC1_16983221e-72Oryza sativa RAc1 mRNA for actin.713008429 (27)gb:AF548026_18107163e-54Stevia rebaudiana actin mRNA, complete cds.
JMFF043C14Sequence653008429 (27)gb:AY360221_16020411e-99Ricinus communis actin (ACT) mRNA, complete cds.
JMFF045F22Sequence647015004gb:AY360221_16020413e-87Ricinus communis actin (ACT) mRNA, complete cds.616008429 (27)gb:AY372368_16032431e-71Trifolium pratense actin mRNA, complete cds.
JMFF051J04Sequence558008429 (27)gb:AY360221_16020416e-79Ricinus communis actin (ACT) mRNA, complete cds.502008429 (27)gb:AF548026_18107163e-45Stevia rebaudiana actin mRNA, complete cds.
JMFS169C04Sequence605008429 (27)gb:GMU60496_1680712e-109Glycine max actin (Soy86) gene, partial cds.
JMSF018L07Sequence560008429 (27)gb:AY360221_16020415e-80Ricinus communis actin (ACT) mRNA, complete cds.758008429 (27)gb:AF548026_1810716e-100Stevia rebaudiana actin mRNA, complete cds.
JMSF019C21Sequence645008429 (27)gb:AY372368_16032432e-74Trifolium pratense actin mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF018L07- GATTGATTCTCCTTTCTA
JMFF051J04- GATTCTCCTTTCTA
JMFF016D15- ATTGATTCTCCTTTCTA
JMFF014A06- GATTCTCCTTTCTA
JMFF035N23- GATTCTCCTTTCTA
JMFF006F14- ATTGATTCTCCTTTCTA
JMFF029P08- ATTGGTTCTCCTTTCTA
JMFF029M03- ATTGATTCTCCTTTCTA
JMFF006B17- ATTGATTCTCCTTTCTA
JMFF043C14- ATTCTCCTTTCTA
JMFF007M16- GATTCTCCTTTCTA
JMFF015G01- ATTGGTTCTCCTTTCTA
                      ____________________________________________________________
consensus GATTGATTCTCCTTTCTA
 
. : . : . : . : . : . :
JMSF018L07- ACACTCCTCAGCAGCCAGCCAGACAGAGAATCTAGAGAGAGCGAGGCGGCCGGCCATCGT
JMFF051J04- ACACTCCTCAGCAGCCAGCCAGACAGAGAATCTAGAGAGAGCGAGGCGGCCGGCCATCGT
JMFF016D15- ACACTCCTCAGCAGCCAGCCAGACAGAGAATCTAGAGAGAGCGAGGCGGCCGGCCATCGT
JMFF014A06- ACACTCCTCAGCAGCCAGCCAGACAGAGAATCTAGAGAGAGCGAGGCGGCCGGCCATCGT
JMFF035N23- ACACTCCTCAGCAGCCAGCCAGACAGAGAATCTAGAGAGAGCGAGGCGGCCGGCCATCGT
JMFF006F14- ACACTCCTCAGCAGCCAGCCAGACAGAGAATCTAGAGAGAGCGAGGCGGCCGGCCATCGT
JMFF029P08- ACACTCCTCAGCAGCCAGCCAGACAGAGAATCTAGAGAGAGCGAGGCGGCCGGCCATCGT
JMFF029M03- ACACTCCTCAGCAGCCAGCCAGACAGAGAATCTAGAGAGAGCGAGGCGGCCGGCCATCGT
JMFF006B17- ACACTCCTCAGCAGCCAGCCAGACAGAGAATCTAGAGAGAGCGAGGCGGCCGGCCATCGT
JMFF043C14- ACACTCCTCAGCAGCCAGCCAGACAGAGAATCTAGAGAGAGCGAGGCGGCCGGCCATCGT
JMFF007M16- ACACTCCTCAGCAGCCAGCCAGACAGAGAATCTAGAGAGAGCGAGGCGGCCGGCCATCGT
JMFF015G01- ACACTCCTCAGCAGCTAGCCAGACAGAGAATCTAGAGAGAGCGAGGCGGCCGGCCATCGT
                      ____________________________________________________________
consensus ACACTCCTCAGCAGCCAGCCAGACAGAGAATCTAGAGAGAGCGAGGCGGCCGGCCATCGT
 
. : . : . : . : . : . :
JMSF018L07- CTCCGGACTCAAATCTCGTTTTCTCTCACTCCCAGTGTTTAATAGAAAATGGCAGATGCT
JMFF051J04- CTCCGGACTCAAATCTCGTTTTCTCTCACTCTCAGTGTTTAATAGAAAATGGCAGATGCT
JMFF016D15- CTCCGGACTCAAATCTCGTTTTCTCTCACTCTCAGTGTTTAATAGAAAATGGCAGATGCT
JMFF014A06- CTCCGGACTCAAATCTCGTTTTCTCTCACTCTCAGTGTTTAATAGAAAATGGCAGATGCT
JMFF035N23- CTCCGGACTCAAATCTCGTTTTCTCTCACTCTCAGTGTTTAATAGAAAATGGCAGATGCT
JMFF006F14- CTCCGGACTCAAATCTCGTTTTCTCTCACTCTCAGTGTTTAATAGAAAATGGCAGATGCT
JMFF029P08- CTCCGGACTCAAATCTCGTTTTCTCTCACTCTCAGTGTTTAATAGAAAATGGCAGATGCT
JMFF029M03- CTCCGGACTCAAATCTCGTTTTCTCTCACTCTCAGTGTTTAATACAAAATGGCANATGCT
JMFF006B17- CTCCGGACTCAAATCTCGTTTTCTCTCACTCTCAGTGTTTAATAGAAAATGGCAGATGCT
JMFF043C14- CTCCGGACTCAAATCTCGTTTTCTCTCACTCTCAGTGTTTAATAGAAAATGGCAGATGCT
JMFF007M16- CTCCGGACTCAAATCTCGTTTTCTCTCACTCTCAGTGTTTAATAGAAAATGGCAGATGCT
JMFF015G01- CTCCGGACTCAAATCTCGTTTTCTCTCACTCTCAGTGTTTAATAGAAAATGGCAGATGCT
                      ____________________________________________________________
consensus CTCCGGACTCAAATCTCGTTTTCTCTCACTCTCAGTGTTTAATAGAAAATGGCAGATGCT
 
. : . : . : . : . : . :
JMSF018L07- GAGGATATTCAGCCACTTGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCT
JMFF051J04- GAGGATATTCAGCCACTTGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCT
JMFF016D15- GAGGATATTCAGCCACTTGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCT
JMFF014A06- GAGGATATTCAGCCACTTGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCT
JMFF035N23- GAGGATATTCAGCCACTTGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCT
JMFF006F14- GAGGATATTCAGCCACTTGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCT
JMFF029P08- GAGGATATTCAGCCACTTGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCT
JMFF029M03- GAGGATATTCAGCCACTTGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCT
JMFF006B17- GAGGATATTCAGCCACTTGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCT
JMFF043C14- GAGGATATTCAGCCACTTGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCT
JMFF007M16- GAGGATATTCAGCCACTTGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCT
JMFF015G01- GAGGATATTCAGCCACTTGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCT
                      ____________________________________________________________
consensus GAGGATATTCAGCCACTTGTCTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCT
 
. : . : . : . : . : . :
JMSF018L07- GGTGATGATGCTCCAAGAGCAGTGTTTCCCAGTATTGTGGGTCGCCCCCGACACACTGGT
JMFF051J04- GGTGATGATGCTCCAAGAGCAGTGTTTCCCAGTATTGTGGGTCGCCCCCGACACACTGGT
JMFF016D15- GGTGATGATGCTCCAAGAGCAGTGTTTCCCAGTATTGTGGGTCGCCCCCGACACACTGGT
JMFF014A06- GGTGATGATGCTCCAAGAGCAGTGTTTCCCAGTATTGTGGGTCGCCCCCGACACACTGGT
JMFF035N23- GGTGATGATGCTCCAAGAGCAGTGTTTCCCAGTATTGTGGGTCGCCCCCGACACACTGGT
JMFF006F14- GGTGATGATGCTCCAAGAGCAGTGTTTCCCAGTATTGTGGGTCGCCCCCGACACACTGGT
JMFF029P08- GGTGATGATGCTCCAAGAGCAGTGTTTCCCAGTATTGTGGGTCGCCCCCGACACACTGGT
JMFF029M03- GGTGATGATGCTCCAAGAGCAGTGTTTCCCAGTATTGTGGGTCGCCCCCGACACACTGGT
JMFF006B17- GGTGATGATGCTCCAAGAGCAGTGTTTCCCAGTATTGTGGGTCGCCCCCGACACACTGGT
JMFF043C14- GGTGATGATGCTCCAAGAGCAGTGTTTCCCAGTATTGTGGGTCGCCCCCGACACACTGGT
JMFF007M16- GGTGATGATGCTCCAAGAGCAGTGTTTCCCAGTATTGTGGGTCGCCCCCGACACACTGGT
JMFF015G01- GGTGATGATGCTCCAAGAGCAGTGTTTCCCAGTATTGTGGGTCGCCCCCGACACACTGGT
rJMFF029M03+ GGT
                      ____________________________________________________________
consensus GGTGATGATGCTCCAAGAGCAGTGTTTCCCAGTATTGTGGGTCGCCCCCGACACACTGGT
 
. : . : . : . : . : . :
JMSF018L07- GTTATGGTTGGGATGGGACAGAAGGATGCCTATGTGGGTGATGAAGCCCAGTCTAAGAGA
JMFF051J04- GTTATGGTTGGGATGGGACAGAAGGATGCCTATGTGGGTGATGAAGCCCAGTCTAAGAGA
JMFF016D15- GTTATGGTTGGGATGGGACAGAAGGATGCCTATGTGGGTGATGAAGCCCAGTCTAAGAGA
JMFF014A06- GTTATGGTTGGGATGGGACAGAAGGATGCCTATGTGGGTGATGAAGCCCAGTCTAAGAGA
JMFF035N23- GTTATGGTTGGGATGGGACAGAAGGATGCCTATGTGGGTGATGAAGCCCAGTCTAAGAGA
JMFF006F14- GTTATGGTTGGGATGGGACANAAGGATGCCTATGTGGGTGATGAAGCCCAGTCTAANAGA
JMFF029P08- GTTATGGTTGGGATGGGACAGAAGGATGCCTATGTGGGTGATGAAGCCCAGTCTAAGAGA
JMFF029M03- GTTATGGTTGGGATGGGACAGAAGGATGCCTATGTGGGTGATGAAGCCCAGTCTAAGAGA
JMFF006B17- GTTATGGTTGGGATGGGACAGAAGGATGCCTATGTGGGTGATGAAGCCCAGTCTAAGAGA
JMFF043C14- GTTATGGTTGGGATGGGACAGAAGGATGCCTATGTGGGTGATGAAGCCCAGTCTAAGAGA
JMFF007M16- GTTATGGTTGGGATGGGACAGAAGGATGCCTATGTGGGTGATGAAGCCCAGTCTAAGAGA
JMFF015G01- GTTATGGTTGGGATGGGACAGAAGGATGCCTATGTGGGTGATGAAGCCCAGTCTAAGAGA
rJMFF029M03+ GTTATGGTTGGGATGGGACAGAAGGATGCCTATGTGGGTGATGAAGCCCAGTCTAAGAGA
                      ____________________________________________________________
consensus GTTATGGTTGGGATGGGACAGAAGGATGCCTATGTGGGTGATGAAGCCCAGTCTAAGAGA
 
. : . : . : . : . : . :
JMSF018L07- GGTATCTTGACCTTGAAATACCCCATTGAGCATGGTATTGTTAGCAACTGGGATGATATG
JMFF051J04- GGTATCTTGACCTTGAAATACCCCATTGAGCATGGTATTGTTAGCAACTGGGATGATATG
JMFF016D15- GGTATCTTGACCTTGAAATACCCCATTGAGCATGGTATTGTTAGCAACTGGGATGATATG
JMFF014A06- GGTATCTTGACCTTGAAATACCCCATTGAGCATGGTATTGTTAGCAACTGGGATGATATG
JMFF035N23- GGTATCTTGACCTTGAAATACCCCATTGAGCATGGTATTGTTAGCAACTGGGATGATATG
JMFF006F14- GGTATCTTGACCTTGAAATACCCCATTGAGCATGGTATTGTTAGCAACTGGGATGATATG
JMFF029P08- GGTATCTTGACCTTGAAATACCCCATTGAGCATGGTATTGTTAGCAACTGGGATGATATG
JMFF029M03- GGTATCTTGACCTTGAAATACCCCATTGAGCATGGTATTGTTAGCNACTGGGATGATATG
JMFF006B17- GGTATCTTGACCTTGAAATACCCCATTGAGCATGGTATTGTTAGCAACTGGGATGATATG
JMFF043C14- GGTATCTTGACCTTGAAATACCCCATTGAGCATGGTATTGTTAGCAACTGGGATGATATG
JMFF007M16- GGTATCTTGACCTTGAAATACCCCATTGAGCATGGTATTGTTAGCAACTGGGATGATATG
JMFF015G01- GGTATCTTGACCTTGAAATACCCCATTGAGCATGGTATTGTTAGCAACTGGGATGATATG
rJMFF029M03+ GGTATCTTGACCTTGAAATACCCCATTGAGCATGGTATTGTTAGCAACTGGGATGATATG
                      ____________________________________________________________
consensus GGTATCTTGACCTTGAAATACCCCATTGAGCATGGTATTGTTAGCAACTGGGATGATATG
 
. : . : . : . : . : . :
JMSF018L07- GAAAAGATCTGGCATCACACTTTCTACAACGAGCTTCGTGTTGCACCTGAGGAGCACCCT
JMFF051J04- GAAAAGATCTGGCATCACACTTTCTACAACGAGCTTCGTGTTGCACCTGAGGAGCACCCT
JMFF016D15- GAAAAGATCTGGCATCACACTTTCTACAACGAGCTTCGTGTTGCACCTGAGGAGCACCCT
JMFF014A06- GAAAAGATCTGGCATCACACTTTCTACAACGAGCTTCGTGTTGCACCTGAGGAGCACCCT
JMFF035N23- GAAAAGATCTGGCATCACACTTTCTACAACGAGCTTCGTGTTGCACCTGAGGAGCACCCT
JMFF006F14- GAAAAGATCTGGCATCACACTTTCTACAACGAGCTTCGTGTTGCACCTGAGGAGCACCCT
JMFF029P08- GAAAAGATCTGGCATCACACTTTCTACAACGAGCTTCGTGTTGCACCTGAGGAGCACCCT
JMFF029M03- GAAAAGATCTGGCATCACACTTTCTACAACGAGCTTCGTGTTGCACCT
JMFF006B17- GAAAAGATCTGGCATCACACTTTCTACAACGAGCTTCGTGTTGCACCTGAGGAGCACCCT
JMFF043C14- GAAAAGATCTGGCATCACACTTTCTACAACGAGCTTCGTGTTGCACCTGAGGAGCACCCT
JMFF007M16- GAAAAGATCTGGCATCACACTTTCTACAACGAGCTTCGTGTTGCACCTGAGGAGCACCCT
JMFF015G01- GAAAAGATCTGGCATCACACTTTCTACAACGAGCTTCGTGTTGCACCTGAGGAGCACCCT
rJMFF029M03+ GAAAAGATCTGGCATCACACTTTCTACAACGAGCTTCGTGTTGCACCTGAGGAGCACCCT
                      ____________________________________________________________
consensus GAAAAGATCTGGCATCACACTTTCTACAACGAGCTTCGTGTTGCACCTGAGGAGCACCCT
 
. : . : . : . : . : . :
JMSF018L07- GTCCTTCTTACCGAGGCACCCCTCAACCCAAAAGCAAACAGAGAGAAGATGACACAAATC
JMFF051J04- GTCCTTCTTACCGAGGCACCCCTCAACCCAAAAGNCAACAGAGAGAAGATGACANCAATC
JMFF016D15- GTCCTTCTTACCGAGGCACCCCTCAACCCAAAAGCAAACAGAGAGAAGATGACACAAATC
JMFF014A06- GTCCTTCTTACCGAGGCACCCCTCAACCCAAAAGCAAACAGAGAGAAGATGACACAAATC
JMFF035N23- GTCCTTCTTACCGAGGCACCCCTCAACCCAAAAGCAAACAGAGAGAAGATGACACAAATC
JMFF006F14- GTCCTTCTTACCGAGGCACCCCTCAACCCAAAAGCAAACAGAGAGAAGA
JMFF029P08- GTCCTTCTTACCGAGGCACCCCTCAACCCAAAAGCAAACAG
JMFF006B17- GTCCTTCTTACCGAGGCACCCCTCAACCCAAAAGCAAACAGAGAGAAGATGACACAAATC
JMFF043C14- GTCCTTCTTACCGAGGCACCCCTCAACCCAAAAGCAAACAGAGAGAAGATGACACAAATC
JMFF007M16- GTCCTTCTTACCGAGGCACCCCTCAACCCAAAAGCAAACAGAGAGAAGATGACACAAATC
JMFF015G01- GTCCTTCTTACCGAGGCACCCCTCAACCCAAAAGCAAACAGAGAGAAGATGACACAAATC
rJMFF029M03+ GTCCTTCTTACCGAGGCACCCCTCAACCCAAAAGCAAACAGAGAGAAGATGACACAAATC
JMFS169C04- CAAAAGCAAACAGAGAGAAGATGACACAAATC
                      ____________________________________________________________
consensus GTCCTTCTTACCGAGGCACCCCTCAACCCAAAAGCAAACAGAGAGAAGATGACACAAATC
 
. : . : . : . : . : . :
JMSF018L07- ATGTTTGAGACATTTAATGTTCCTGCAATGTATGTTGCCATTCAGGCTGTGCTATCCTTG
JMFF051J04- ATGTTTGAGACATTTAATGTTCCTGCAATGTATGTTGCCATTCNAGCTGTGCTATCCTTG
JMFF016D15- ATGTTTGAGACATTTAATGTTCCTGCAATGTATGTTGCC
JMFF014A06- ATGTTTGAGACATTTAATGTTCCTGCAATGTATGTTGCCATT
JMFF035N23- ATGTTTGAGACATTTAATGT
JMFF006B17- ATGTTTGAGACATTTAATGTTCCTGCAATGTATGTTGCCATTCAGGCTGTGCTATCCTTG
JMFF043C14- ATGTTTGAGACATTTAATGTTCCTGCAATGTATGTTGCCATTCAGGCTGTGCTATCCTTG
JMFF007M16- ATGTTTGAGACATTTAATGTTCCTGCAATGTATGTTGCCATTCAGGCTGTGCTATCCTTG
JMFF015G01- ATGTTTGAGACATTTAATGTTCCTGCAATGTATGTTGCCATTCAGGCTGTGCTATCCTTG
rJMFF029M03+ ATGTTTGAGACATTTAATGTTCCTGCAATGTATGTTGCCATTCAGGCTGTGCTATCCTTG
JMFS169C04- ATGTTTGAGACATTTAATGTTCCTGCAATGTATGTTGCCATTCAGGCTGTGCTATCCTTG
                      ____________________________________________________________
consensus ATGTTTGAGACATTTAATGTTCCTGCAATGTATGTTGCCATTCAGGCTGTGCTATCCTTG
 
. : . : . : . : . : . :
JMSF018L07- TA
JMFF051J04- TATG
JMFF006B17- TATGCCAGTGGACGTACAAC
JMFF043C14- TATGCCAGTGGACGTACAACTGGTATTGTGCTGGATTCTGGTGATGGTGTGAGCCATACT
JMFF007M16- TATGCCAGTGGACGTACAACTGGTATTGTGCTGGATTCTGGTGATGGTGTGAGCCATACT
JMFF015G01- TATGCCAGTGGACGTACAACTGGTATTGTGCTGGATTCTGGTGATGGTGTGAGCCATACT
rJMFF029M03+ TATGCCAGTGGACGTACAACTGGTATTGTGCTGGATTCTGGTGATGGTGTGAGCCATACT
JMFS169C04- TATGCCAGTGGACGTACAACTGGTATTGTGCTGGATTCTGGTGATGGTGTGAGCCATACT
                      ____________________________________________________________
consensus TATGCCAGTGGACGTACAACTGGTATTGTGCTGGATTCTGGTGATGGTGTGAGCCATACT
 
. : . : . : . : . : . :
JMFF043C14- GTACCCATCTATGAAGGTTATGCCCTTCCTCATGCC
JMFF007M16- GTACCCATCTATGAAGGGTATGCCCTTCCTCA
JMFF015G01- GTACCCATCTATGAAGGTTATGCCCTTCCTCATGCCAT
rJMFF029M03+ GTACCCATCTATGAAGGTTATGCCCTTCCTCATGCCATTCTTCGTTTGGACCTTGCTGGC
JMFS169C04- GTACCCATCTATGAAGGTTATGCCCTTCCTCATGCCATTCTTCGTTTGGACCTTGCTGGC
                      ____________________________________________________________
consensus GTACCCATCTATGAAGGTTATGCCCTTCCTCATGCCATTCTTCGTTTGGACCTTGCTGGC
 
. : . : . : . : . : . :
rJMFF029M03+ CGTGACCTCACCGATCAC
JMFS169C04- CGTGACCTCACCGATCACCTTATG-AAGATCCTAACTGAAAGAGGTTACATGTTCACTAC
rJMSF018L07+ CCGATCACCTTATGAAAGATCCTAACTGAAAGAGGTTACATGTTCACTAC
rJMFF006B17+ AAGATCNTAACTGAAAGAGGTTACATGTTCACTAC
rJMFF016D15+ AACTGAAAGAGGTTACATGTTCACTAC
                      ____________________________________________________________
consensus CGTGACCTCACCGATCACCTTATGAAAGATCCTAACTGAAAGAGGTTACATGTTCACTAC
 
. : . : . : . : . : . :
JMFS169C04- TACTGCTGAGCGGGAAATTGTCCGTGACATGAAGGAAAAGCTTGCATATGTGGCCCTTGA
rJMSF018L07+ TACTGCTGAGCGGGAAATTGTCCGTGACATGAAGGAAAAGCTTGCATATGTGGCCCTTGA
rJMFF015G01+ GA
rJMFF006B17+ TACTGCTGAGCGGGAAATTGTCCGTGACATGAAGGAAAAGCTTGCATATGTGGCCCTTGA
rJMFF016D15+ TACTGCTGAGCGGGAAATTGTCCGTGACATGAAGGAAAAGCTTGCATATGTGGCCCTTGA
rJMFF007M16+ TGAAGGAAAAGCTTGCATATGTGGCCCTTGA
rJMFF014A06+ CATGAAGGAAAAGCTTGCATATGTGGCCCTTGA
                      ____________________________________________________________
consensus TACTGCTGAGCGGGAAATTGTCCGTGACATGAAGGAAAAGCTTGCATATGTGGCCCTTGA
 
. : . : . : . : . : . :
JMFS169C04- CTATGAGCAAGAGCTTGAAACTGCAAAGAGCAGCTCCTCTGTTGAGAAGAACTATGAGTT
rJMSF018L07+ CTATGAGCAAGAGCTTGAAACTGCAAAGAGCAGCTCCTCTGTTGAGAAGAACTATGAGTT
rJMFF015G01+ CTATGAGCAAGAGCTTGAAACTGCAAAGAGCAGCTCCTCTGTTGAGAAGAACTATGAGTT
rJMSF019C21+ TATGAGCAAGAGCTTGAAACTGCAAAGAGCAGCTCCTCNGTTGAGAAGAACTATGAGTT
rJMFF006B17+ CTATGAGCAAGAGCTTGAAACTGCAAAGAGCAGCTCCTCTGTTGAGAAGAACTATGAGTT
rJMFF016D15+ CTATGAGCAAGAGCTTGAAACTGCAAAGAGCAGCTCCTCTGTTGAGAAGAACTATGAGTT
rJMFF007M16+ CTATGAGCAAGAGCTTGAAACTGCAAAGAGCAGCTCCTCTGTTGAGAAGAACTATGAGTT
rJMFF014A06+ CTATGAGCAAGAGCTTGAAACTGCAAAGAGCAGCTCCTCTGTTGAGAAGAACTATGAGTT
                      ____________________________________________________________
consensus CTATGAGCAAGAGCTTGAAACTGCAAAGAGCAGCTCCTCTGTTGAGAAGAACTATGAGTT
 
. : . : . : . : . : . :
JMFS169C04- GCCCGATGGGCAGGTCATAACTATCGGAGCAGAGAGGTTCCGTTGCCCAGAAGTCCTCTT
rJMSF018L07+ GCCCGATGGGCAGGTCATAACTATCGGAGCAGAGAGGTTCCGTTGCCCAGAAGTCCTCTT
rJMFF015G01+ GCCCGATGGGCAGGTCATAACTATCGGAGCAGAGAGGTTCCGTTGCCCAGAAGTCCTCTT
rJMSF019C21+ GCCCGATGGGCAGGTCNTAACTATNGGAGCAGAGAGGTTCCNTTGCCCAGAAGTCCTCTT
rJMFF006B17+ GCCCGATGGGCAGGTCATAACTATCGGAGCAGAGAGGTTCCGTTGCCCAGAAGTCCTCTT
rJMFF016D15+ GCCCGATGGGCAGGTCATAACTATCGGAGCAGAGAGGTTCCGTTGCCCAGAAGTCCTCTT
rJMFF045F22+ GCCCGATGGGCAGGTCATAACTATCGGAGCAGAGAGGTTCCGTTGCCCAGAAGTCCTCTT
rJMFF007M16+ GCCCGATGGGCAGGTCATAACTATCGGAGCAGAGAGGTTCCGTTGCCCAGAAGTCCTCTT
rJMFF014A06+ GCCCGATGGGCAGGTCATAACTATCGGAGCAGAGAGGTTCCGTTGCCCAGAAGTCCTCTT
rJMFF029P08+ TCGGAGCAGAGAGNTTCCGTTGCCAAGAAGTCNTNTT
                      ____________________________________________________________
consensus GCCCGATGGGCAGGTCATAACTATCGGAGCAGAGAGGTTCCGTTGCCCAGAAGTCCTCTT
 
. : . : . : . : . : . :
JMFS169C04- -CCAGCCATCTATGATTGGAATGGAAGCTGCTGGTATT-CACGAGACTACTTACAACT-C
rJMSF018L07+ -CCAGCCATCTATGATTGGAATGGAAGCTGCTGGTATT-CACGAGACTACTTACAACT-C
rJMFF015G01+ -CCAGCCATCTATGATTGGAATGGAAGCTGCTGGTATT-CACGAGACTACTTACAACT-C
rJMSF019C21+ -CCANCCATCTATGATTGGAATGGAAGCTGCTGGTATT-CACGAGACTACTTACAACT-C
rJMFF006B17+ -CCAGCCATCTATGATTGGAATGGAAGCTGCTGGTATT-CACGAGACTACTTACAACT-C
rJMFF016D15+ -CCAGCCATCTATGATTGGAATGGAAGCTGCTGGTATT-CACGAGACTACTTACAACT-C
rJMFF045F22+ -CCAGCCATCTATGATTGGAATGGAAGCTGCTGGTATT-CACGAGACTACTTACAACT-C
rJMFF007M16+ -CCAGCCATCTATGATTGGAATGGAAGCTGCTGGTATT-CACGAGACTACTTACAACT-C
rJMFF014A06+ -CCAGCCATCTATGATTGGAATGGAAGCTGCTGGTATT-CACGAGACTACTTACAACT-C
rJMFF029P08+ CCCAGCCATCTATGATTGGAATGGAAGCTGCTGGTATTCCACGAGACTACTTACAACTCC
rJMFF035N23+ AAGCTGCTGGTATT-CACGAGACTACTTACAACT-C
rJMFF006F14+ GGAAGCTGCTGGTATT-CACGAGACTACTTACAACT-C
                      ____________________________________________________________
consensus -CCAGCCATCTATGATTGGAATGGAAGCTGCTGGTATT-CACGAGACTACTTACAACT-C
 
. : . : . : . : . : . :
JMFS169C04- CATTATGAAGTGTGATGTAGATATCAGGAAGGATCTCTATGGTAATATTGTTCTCAGTGG
rJMSF018L07+ CATTATGAAGTGTGATGTAGATATCAGGAAGGATCTCTATGGTAATATTGTTCTCAGTGG
rJMFF015G01+ CATTATGAAGTGTGATGTAGATATCAGGAAGGATCTCTATGGTAATATTGTTCTCAGTGG
rJMSF019C21+ CATTATGAAGTGTGANGTAGATATCAGGAAGGATCTCTATGGTAATANTGTTCTCAGTGG
rJMFF006B17+ CATTATGAAGTGTGATGTAGATATCAGGAAGGATCTCTATGGTAATATTGTTCTCAGTGG
rJMFF016D15+ CATTATGAAGTGTGATGTAGATATCAGGAAGGATCTCTATGGTAATATTGTTCTCAGTGG
rJMFF045F22+ CATTATGAAGTGTGATGTAGATATCAGGAAGGATCTCTATGGTAATATTGTTCTCAGTGG
rJMFF007M16+ CATTATGAAGTGTGATGTAGATATCAGGAAGGATCTCTATGGTAATATTGTTCTCAGTGG
rJMFF014A06+ CATTATGAAGTGTGATGTAGATATCAGGAAGGATCTCTATGGTAATATTGTTCTCAGTGG
rJMFF029P08+ CATTATGAAGTGTGATGTAGATATCAGGAAGGATCTCTATGGTAATATTGTTCTCAGTGG
rJMFF035N23+ CATTATGAAGTGTGATGTAGATATCAGGAAGGATCTCTATGGTAATATTGTTCTCAGTGG
rJMFF051J04+ GATGTAGATATCAGGAAGGATCTCTATGGTAATATTGTTCTCAGTGG
rJMFF006F14+ CATTATGAAGTGTGATGTAGATATCAGGAAGGATCTCTATGGTAATATTGTTCTCAGTGG
                      ____________________________________________________________
consensus CATTATGAAGTGTGATGTAGATATCAGGAAGGATCTCTATGGTAATATTGTTCTCAGTGG
 
. : . : . : . : . : . :
JMFS169C04- TGGCTCTACAATGTTCCCTGGTATTGCTGATCGGATG
rJMSF018L07+ TGGCTCTACAATGTTCCCTGGTATTGCTGATCGGATGAGCAAGGAAATCACTGCTTTAG-
rJMFF015G01+ TGGCTCTACAATGTTCCCTGGTATTGCTGATCGGATGAGCAAGGAAATCACTGCTTTAG-
rJMSF019C21+ TGGCTNTACAANGTTCCCTGGTATTNNTGATCGGATGAGCAAGGAAATCACTGCTTTAG-
rJMFF006B17+ TGGCTCTACAATGTTCCCTGGTATTGCTGATCGGATGAGCAAGGAAATCACTGCTTTAG-
rJMFF016D15+ TGGCTCTACAATGTTCCCTGGTATTGCTGATCGGATGAGCAAGGAAATCACTGCTTTAGC
rJMFF045F22+ TGGCTCTACAATGTTCCCTGGTATTGCTGATCGGATGAGCAAGGAAATCACTGCTTTAG-
rJMFF007M16+ TGGCTCTACAATGTTCCCTGGTATTGCTGATCGGATGAGCAAGGAAATCACTGCTTTAG-
rJMFF014A06+ TGGCTCTACAATGTTCCCTGGTATTGCTGATCGGATGAGCAAGGAAATCACTGCTTTAG-
rJMFF029P08+ TGGCTCTACAATGTTCCCTGGTATTGCTGATCGGATGAGCAAGGAAATCACTGCTTTAG-
rJMFF035N23+ TGGCTCTACAATGTTCCCTGGTATTGCTGATCGGATGAGCAAGGAAATCACTGCTTTAG-
rJMFF051J04+ TGGCTCTACAATGTTCCCTGGTATTGCTGATCGGATGAGCAAGGAAATCACTGCTTTAG-
rJMFF006F14+ TGGCTCTACAATGTTCCCTGGTATTGCTGATCGGATGAGCAAGGAAATCACTGCTTTAG-
                      ____________________________________________________________
consensus TGGCTCTACAATGTTCCCTGGTATTGCTGATCGGATGAGCAAGGAAATCACTGCTTTAG-
 
. : . : . : . : . : . :
rJMSF018L07+ CCCCCAGCAGCATGAAGATTAAGGTGGTTGCTCCACCAGAAAGAAAATACAGTGTTTGGA
rJMFF015G01+ CCCCCAGCAGCATGAAGATTAAGGTGGTTGCTCCACCAGAAAGAAAATACAGTGTTTGGA
rJMSF019C21+ CCCCCAGCAGCNNGAAGATTAAGGTGGTTNCTCCACCAGAAAGAAAATACAGTGTTTGGA
rJMFF006B17+ CCCCCAGCAGCATGAAGATTAAGGTGGTTGCTCCACCAGAAAGAAAATACAGTGTTTGGA
rJMFF016D15+ CCCCCAGCAGCATGAAGATTAAGGTGGTTGCTCCACCAGAAAGAAAATACAGTGTTTGGA
rJMFF045F22+ CCCCCAGCAGCATGAAGATTAAGGTGGTTGCTCCACCAGAAAGAAAATACAGTGTTTGGA
rJMFF007M16+ CCCCCAGCAGCATGAAGATTAAGGTGGTTGCTCCACCAGAAAGAAAATACAGTGTTTGGA
rJMFF014A06+ CCCCCAGCAGCATGAAGATTAAGGTGGTTGCTCCACCAGAAAGAAAATACAGTGTTTGGA
rJMFF029P08+ CCCCCAGCAGCATGAAGATTAAGGTGGTTGCTCCACCAGAAAGAAAATACAGTGTTTGGA
rJMFF035N23+ CCCCCAGCAGCATGAAGATTAAGGTGGTTGCTCCACCAGAAAGAAAATACAGTGTTTGGA
rJMFF051J04+ CCCCCAGCAGCATGAAGATTAAGGTGGTTGCTCCACCAGAAAGAAAATACAGTGTTTGGA
rJMFF006F14+ CCCCCAGCAGCATGAAGATTAAGGTGGTTGCTCCACCAGAAAGAAAATACAGTGTTTGGA
                      ____________________________________________________________
consensus CCCCCAGCAGCATGAAGATTAAGGTGGTTGCTCCACCAGAAAGAAAATACAGTGTTTGGA
 
. : . : . : . : . : . :
rJMSF018L07+ TTGGAGGATCCATCCTCGCATCCCTCAGCACTTTCCAGCAGATGTGGATTTCGAAAGGGG
rJMFF015G01+ TTGGAGGATCCATCCTCGCATCCCTCAGCACTTTCCAGCAGATGTGGATTTCGAAAGGGG
rJMSF019C21+ TTGGAGGATCCATCCTCGCNTCCCTCAGCACTTTNCAGCAGANGTGGATTTCGAAAGGGG
rJMFF006B17+ TTGGAGGATCCATCCTCGCATCCCTCAGCACTTTCCAGCAGATGTGGATTTCGAAAGGGG
rJMFF016D15+ TTGGAGGATCCATCCTCGCATCCCTCAGCACTTTCCAGCAGATGTGGATTTCGAAAGGGG
rJMFF045F22+ TTGGAGGATCCATCCTCGCATCCCTCAGCACTTTCCAGCAGATGTGGATTTCGAAAGGGG
rJMFF007M16+ TTGGAGGATCCATCCTCGCATCCCTCAGCACTTTCCAGCAGATGTGGATTTCGAAAGGGG
rJMFF014A06+ TTGGAGGATCCATCCTCGCATCCCTCAGCACTTTCCAGCAGATGTGGATTTCGAAAGGGG
rJMFF029P08+ TTGGAGGATCCATCCTCGCATCCCTCAGCACTTTCCAGCAGATGTGGATTTCGAAAGGGG
rJMFF035N23+ TTGGAGGATCCATCCTCGCATCCCTCAGCACTTTCCAGCAGATGTGGATTTCGAAAGGGG
rJMFF051J04+ TTGGAGGATCCATCCTCGCATCCCTCAGCACTTTCCAGCAGATGTGGATTTCGAAAGGGG
rJMFF006F14+ TTGGAGGATCCATCCTCGCATCCCTCAGCACTTTCCAGCAGATGTGGATTTCGAAAGGGG
                      ____________________________________________________________
consensus TTGGAGGATCCATCCTCGCATCCCTCAGCACTTTCCAGCAGATGTGGATTTCGAAAGGGG
 
. : . : . : . : . : . :
rJMSF018L07+ AGTATGAGGAGTCTGGCCCATCAATTGTCCACAGGAAGTGCTTCTAAGATGCTACTACTA
rJMFF015G01+ AGTATGAGGAGTCTGGCCCATCAATTGTCCACAGGAAGTGCTTCTAAGATGCTACTACTA
rJMSF019C21+ AGTATGAGGAGTCTGGCCCATCAATTGTCCACAGGAAGTGCTTCTAAGATGCTACTACTA
rJMFF006B17+ AGTATGAGGAGTCTGGCCCATCAATTGTCCACAGGAAGTGCTTCTAAGATGCTACTACTA
rJMFF016D15+ AGTATGAGGAGTCTGGCCCATCAATTGTCCACAGGAAGTGCTTCTAAGATGCTACTACTA
rJMFF045F22+ AGTATGAGGAGTCTGGCCCATCAATTGTCCACAGGAAGTGCTTCTAAGATGCTACTACTA
rJMFF007M16+ AGTATGAGGAGTCTGGCCCATCAATTGTCCACAGGAAGTGCTTCTAAGATGCTACTACTA
rJMFF014A06+ AGTATGAGGAGTCTGGCCCATCAATTGTCCACAGGAAGTGCTTCTAAGATGCTACTACTA
rJMFF029P08+ AGTATGAGGAGTCTGGCCCATCAATTGTCCACAGGAAGTGCTTCTAAGATGCTACTACTA
rJMFF035N23+ AGTATGAGGAGTCTGGCCCATCAATTGTCCACAGGAAGTGCTTCTAAGATGCTACTACTA
rJMFF051J04+ AGTATGAGGAGTCTGGCCCATCAATTGTCCACAGGAAGTGCTTCTAAGATGCTACTACTA
rJMFF006F14+ AGTATGAGGAGTCTGGCCCATCAATTGTCCACAGGAAGTGCTTCTAAGATGCTACTACTA
                      ____________________________________________________________
consensus AGTATGAGGAGTCTGGCCCATCAATTGTCCACAGGAAGTGCTTCTAAGATGCTACTACTA
 
. : . : . : . : . : . :
rJMSF018L07+ TTTTAAAGGGGTGGCCACTTGTGTTTGCCTCTTCTGCCTAGACGTGTCATTGCTGGTA-G
rJMFF015G01+ TTTTAAAGGGGTGGCCACTTGTGTTTGCCTCTTCTGCCTAGACGTGTCATTGCTGGTA-G
rJMSF019C21+ TTTTAAAGGGGTGGCCACTTGTGTTTGCCTCTTCTNCCTAGACGNGTCATTGCNGGTACG
rJMFF021B22+ TTCTGCCTAGACGTGTCATTGCTGGTA-G
rJMFF006B17+ TTTTAAAGGGGTGGCCACTTGTGTTTGCCTCTTCTGCCTAGACGTGTCATTGCTGGTA-G
rJMFF016D15+ TTTTAAAGGGGTGGCCACTTGTGTTTGCCTCTTCTGCCTAGACGTGTCATTGCTGGTA-G
rJMFF045F22+ TTTTAAAGGGGTGGCCACTTGTGTTTGCCTCTTCTGCCTAGACGTGTCATTGCTGGTA-G
rJMFF007M16+ TTTTAAAGGGGTGGCCACTTGTGTTTGCCTCTTCTGCCTAGACGTGTCATTGCTGGTA-G
rJMFF014A06+ TTTTAAAGGGGTGGCCACTTGTGTTTGCCTCTTCTGCCTAGACGTGTCATTGCTGGTA-G
rJMFF029P08+ TTTTAAAGGGGTGGCCACTTGTGTTTGCCTCTTCTGCCTAGACGTGTCATTGCTGGTA-G
rJMFF035N23+ TTTTAAAGGGGTGGCCACTTGTGTTTGCCTCTTCTGCCTAGACGTGTCATTGCTGGTA-G
rJMFF051J04+ TTTTAAAGGGGTGGCCACTTGTGTTTGCCTCTTCTGCCTAGACGTGTCATTGCTGGTA-G
rJMFF006F14+ TTTTAAAGGGGTGGCCACTTGTGTTTGCCTCTTCTGCCTAGACGTGTCATTGCTGGTA-G
                      ____________________________________________________________
consensus TTTTAAAGGGGTGGCCACTTGTGTTTGCCTCTTCTGCCTAGACGTGTCATTGCTGGTA-G
 
. : . : . : . : . : . :
rJMSF018L07+ GTGTTTGTAGTTGGAGAGTGAGTGGTTGTGATGTTGTTTTCTTCAATTTTCTTCTTTCTC
rJMFF015G01+ GTGTTTGTAGTTGGAGAGTGAGTGGTTGTGATGTTGTTTTCTTCAATTTTCTTCTTTCTC
rJMSF019C21+ GTGTTNGTAGTTGGNGAGTGAGTGGTTGTGATGTTGTNTTCTTCAATTTTCTTCTTTCTC
rJMFF021B22+ GTGTTTGTAGTTGGAGAGTGAGTGGTTGTGATGTTGTTTTCTTCAATTTTCTTCTTTCTC
rJMFF006B17+ GTGTTTGTAGTTGGAGAGTGAGTGGTTGTGATGTTGTTTTCTTCAATTTTCTTCTTTCTC
rJMFF016D15+ GTGTTTGTAGTTGGAGAGTGAGTGGTTGTGATGTTGTTTTCTTCAATTTTCTTCTTTCTC
rJMFF045F22+ GTGTTTGTAGTTGGAGAGTGAGTGGTTGTGATGTTGTTTTCTTCAATTTTCTTCTTTCTC
rJMFF007M16+ GTGTTTGTAGTTGGAGAGTGAGTGGTTGTGATGTTGTTTTCTTCAATTTTCTTCTTTCTC
rJMFF014A06+ GTGTTTGTAGTTGGAGAGTGAGTGGTTGTGATGTTGTTTTCTTCAATTTTCTTCTTTCTC
rJMFF029P08+ GTGTTTGTAGTTGGAGAGTGAGTGGTTGTGATGTTGTTTTCTTCAATTTTCTTCTTTCTC
rJMFF035N23+ GTGTTTGTAGTTGGAGAGTGAGTGGTTGTGATGTTGTTTTCTTCAATTTTCTTCTTTCTC
rJMFF051J04+ GTGTTTGTAGTTGGAGAGTGAGTGGTTGTGATGTTGTTTTCTTCAATTTTCTTCTTTCTC
rJMFF006F14+ GTGTTTGTAGTTGGAGAGTGAGTGGTTGTGATGTTGTTTTCTTCAATTTTCTTCTTTCTC
                      ____________________________________________________________
consensus GTGTTTGTAGTTGGAGAGTGAGTGGTTGTGATGTTGTTTTCTTCAATTTTCTTCTTTCTC
 
. : . : . : . : . : . :
rJMSF018L07+ TTCCCAATTTCTTATTATATGGGGCTCTTTTTATCAACGGACCAAGGTTATGT
rJMFF015G01+ TTCCCAATTTCTTATTATATGGGGCTCTTTTTATCAACGGA-CAAGGTTATGTTAATATT
rJMSF019C21+ TTCCCAATTTCTTATTATATGGGGCTCTNTTTATCAACGGA-CAAGGTTAT
rJMFF021B22+ TTCCCAATTTCTTATTATATGGGGCTCTTTTTATCAACGGA-CAAGGTTATGTTAATATT
rJMFF006B17+ TTCCCAATTTCTTATTATATGGGGCTCTTTTTATCAACGGA-CAAGGTTATGTTAATATT
rJMFF016D15+ TTCCCAATTTCTTATTATATGGGGCTCTTTTTATCAACGGA-CAAGGTTATGTTAATATT
rJMFF045F22+ TTCCCAATTTCTTATTATATGGGGCTCTTTTTATCAACGGA-CAAGGTTATGTTAATATT
rJMFF007M16+ TTCCCAATTTCTTATTATATGGGGCTCTTTTTATCAACGGA-CAAGGTTATGTTAATATT
rJMFF014A06+ TTCCCAATTTCTTATTATATGGGGCTCTTTTTATCAACGGA-CAAGGTTATGTTAATATT
rJMFF029P08+ TTCCCAATTTCTTATTATATGGGGCTCTTTTTATCAACGGA-CAAGGTTATGTTAATATT
rJMFF035N23+ TTCCCAATTTCTTATTATATGGGGCTCTTTTTATCAACGGA-CAAGGTTATGTTAATATT
rJMFF051J04+ TTCCCAATTTCTTATTATATGGGGCTCTTTTTATCAACGGA-CAAGGTTATGTTAATATT
rJMFF006F14+ TTCCCAATTTCTTATTATATGGGGCTCTTTTTATCAACGGA-CAAGGTTATGTTAATATT
                      ____________________________________________________________
consensus TTCCCAATTTCTTATTATATGGGGCTCTTTTTATCAACGGA-CAAGGTTATGTTAATATT
 
. : . : . : . : . : . :
rJMFF015G01+ TATTGTACCAGAAT
rJMFF021B22+ TATTGTACCAGAA
rJMFF006B17+ TATTGTACCAGAAT
rJMFF016D15+ TATTGTACCAGAATT
rJMFF045F22+ TATTGTACCAGAATTTTATG
rJMFF007M16+ TATTGTACCAGAATTTTATGGCAGTGATTGTTTTGGGGAATTATGAGCCTGGCCAGATTG
rJMFF014A06+ TATTGTACCAGAATTTTATAGCAGTGATTGTTTTGGGGAATTATGAGCCTGGCCAGATTG
rJMFF029P08+ TATTGTACCAGAATTTTATGGCAGTGATTGTTTTGGGGAATTATGAGCCTGGCCAGATTG
rJMFF035N23+ TATTGTACCAGAATTTTATGGCAGTGATTGTTTTGGGGAATTATGAGCCTGGCCAGATTG
rJMFF051J04+ TATTGTACCAGAATTTTATGGCAGTGATTGTTTTGGGG
rJMFF006F14+ TATTGTACCAGAATTTTATGGCAGTGATTGTTTTGGGGAATTATGAGCCTGGCCAGATTG
                      ____________________________________________________________
consensus TATTGTACCAGAATTTTATGGCAGTGATTGTTTTGGGGAATTATGAGCCTGGCCAGATTG
 
. : . : . : . : . : . :
rJMFF007M16+ AAAGGTTCCTAGGTTTTTTTTCGTGTGGATGTAGAAAT
rJMFF014A06+ AAAGGTTCCTAGGTTTTTTTTCGTGTGGATGTAGAAATTTTTTGGGGGCTTAGCGCACCC
rJMFF029P08+ AAAGGTTCCTAGGTTTTTTTTCGTGTGGATGTAGAAATTTTTTGGGGGCTTAGCGCACCC
rJMFF035N23+ AAAGGTTCCTAGGTTTTTTTTCGTGTGGATGTAGAAATTTTTTGGGGGCTTAGCGCACCC
rJMFF006F14+ AAAGGTTCCTAGGTTTTTTTTCGTGTGGATGTAGAAATTTTTTGGGGGCTTAGCGCACCC
                      ____________________________________________________________
consensus AAAGGTTCCTAGGTTTTTTTTCGTGTGGATGTAGAAATTTTTTGGGGGCTTAGCGCACCC
 
. : . : . : . : . : . :
rJMFF014A06+ ATCTAAATTTGTGGGAAAC
rJMFF029P08+ ATCTAAATTTGTGGGAAACTTTGTTTTGAGTGTATCCCTTGCATTTTGGTCCATTCCTGG
rJMFF035N23+ ATCTAAATTTGTGGGAAACTTTGTTTTGAGTGTATCCCTTGCATTTTGGTCCATTCCTGG
rJMFF006F14+ ATCTAAATTTGTGGGAAACTTTGTTTTGAGTGTATCCCTTGCATTTTGGTCCATTCCTGG
                      ____________________________________________________________
consensus ATCTAAATTTGTGGGAAACTTTGTTTTGAGTGTATCCCTTGCATTTTGGTCCATTCCTGG
 
. : . : . : . : . : . :
rJMFF029P08+ -TTGAATCAAGAG-AACAAACAGC
rJMFF035N23+ -TTGAATCAAGAG-AACAAACAGC
rJMFF006F14+ TTTGAATCAAGAGTAACAAACAGCCTTGTCCTGTATTGCTGCCATTTTCATATTCATAAA
                      ____________________________________________________________
consensus -TTGAATCAAGAG-AACAAACAGCCTTGTCCTGTATTGCTGCCATTTTCATATTCATAAA