Previous Contig 008422:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006E18Sequence643000306 (2)gb:AF298827_17841944e-56Prunus avium 60S ribosomal protein L24 (RL24) mRNA, complete cds.748008422 (6)gb:AB010692_15111113e-23Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18I23.>gb:AK175650_18
JMFF025M08Sequence537008422 (6)gb:ATH249727_15521415e-26Arabidopsis thaliana mRNA for prenylated Rab receptor 2 (pra2 gene).739008422 (6)gb:ATH249727_15521413e-23Arabidopsis thaliana mRNA for prenylated Rab receptor 2 (pra2 gene).
JMFF027H21Sequence643000306 (2)gb:AF298827_17841944e-56Prunus avium 60S ribosomal protein L24 (RL24) mRNA, complete cds.740008422 (6)gb:ATH249727_15521413e-23Arabidopsis thaliana mRNA for prenylated Rab receptor 2 (pra2 gene).
JMFN017C22Sequence623008422 (6)gb:ATH249727_15521417e-37Arabidopsis thaliana mRNA for prenylated Rab receptor 2 (pra2 gene).
JMSF013K19Sequence376008422 (6)gb:ATH249727_15521411e-17Arabidopsis thaliana mRNA for prenylated Rab receptor 2 (pra2 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF013K19- CAGTAAAAGAATCGCACTTGTTAACGTCTGAGT
JMFF025M08- AGTAAAAGAATCGCACTTGTTAACGTCTGAGT
                      ____________________________________________________________
consensus CAGTAAAAGAATCGCACTTGTTAACGTCTGAGT
 
. : . : . : . : . : . :
JMSF013K19- CGGCCGTCTCTCTCTTCTCTCCACCCTCGATTACACAAGGAGAGAGAGAGATTCAGAGAA
JMFF025M08- CGGCCGTCTCTCTCTTCTCTCCACCCTCGATTACACAAGGAGAGAGAGAGATTCAGAGAA
                      ____________________________________________________________
consensus CGGCCGTCTCTCTCTTCTCTCCACCCTCGATTACACAAGGAGAGAGAGAGATTCAGAGAA
 
. : . : . : . : . : . :
JMSF013K19- CACACAAAGATGGCTTCACCCGCGACGATTCCGATCTCGGCTCCTCAATCCGCCGCCGGC
JMFF025M08- CACACAAAGATGGCTTCACCCGCGACGATTCCGATCTCGGCTCCTCAATCCGCCGCCGGC
                      ____________________________________________________________
consensus CACACAAAGATGGCTTCACCCGCGACGATTCCGATCTCGGCTCCTCAATCCGCCGCCGGC
 
. : . : . : . : . : . :
JMSF013K19- CAAGCTCAGACGGCAATCTCCACTCCAGCTTTCCGGGCGTTCATCTCCCGGATTTCCTCC
JMFF025M08- CAAGCTCAGACGGCAATCTCCACTCCAGCTTTCCGGGCGTTCATCTCCCGGATTTCCTCC
                      ____________________________________________________________
consensus CAAGCTCAGACGGCAATCTCCACTCCAGCTTTCCGGGCGTTCATCTCCCGGATTTCCTCC
 
. : . : . : . : . : . :
JMSF013K19- TCCATCAGGCAAGGCTTGTCTCTGCGACGCCCGTGGTCGGAGCTTCTGGATCGGACCTCC
JMFF025M08- TCCATCAGGCAAGGCTTGTCTCTGCGACGCCCGTGGTCGGAGCTTCTGGATCGGACCTCC
                      ____________________________________________________________
consensus TCCATCAGGCAAGGCTTGTCTCTGCGACGCCCGTGGTCGGAGCTTCTGGATCGGACCTCC
 
. : . : . : . : . : . :
JMSF013K19- TTTTCCCGGCCGGACACTCTCTCCGAGGCCGCCTCGCGCGTGCGCAAGAACTTCTCATAC
JMFF025M08- TTTTCCCGGCCGGACACTCTCTCCGAGGCCGCCTCGCGCGTGCGCAAGAACTTCTCATAC
JMFN017C22- CGGCCGGACACTCTCTCCGAGGCCGCCTCGCGCGTGCGCAAGAACTTCTCATAC
rJMFF027H21+ TCGCGCGTGCGCAAGAACTTCTCATAC
rJMFF025M08+ TCGCGCGTGCGCAAGAACTTCTCATAC
rJMFF006E18+ TCGCGCGTGCGCAAGAACTTCTCATAC
                      ____________________________________________________________
consensus TTTTCCCGGCCGGACACTCTCTCCGAGGCCGCCTCGCGCGTGCGCAAGAACTTCTCATAC
 
. : . : . : . : . : . :
JMSF013K19- -TTCCGCGTC-AACTACGTTACTTTACTCGCCGCCGTACTCGCTT
JMFF025M08- -TTCCGCGTC-AACTACGTTACTTTACTCGCCGCCGTACTCGCTTTCTCGCTCCTCTCTC
JMFN017C22- -TTCCGCGTC-AACTACGTTACTTTACTCGCCGCCGTACTCGCTTTCTCGCTCCTCTCTC
rJMFF027H21+ TTTCCGCGTCAAACTACGTTACTTTACTCGCCGCCGTACTCGCTTTCTCGCTCCTCTCTC
rJMFF025M08+ TTTCCGCGTCAAACTACGTTACTTTACTCGCCGCCGTACTCGCTTTCTCGCTCCTCTCTC
rJMFF006E18+ -TTCCGCGTCAAACTACGTTACTTTACTCGCCGCCGTACTCGCTTTCTCGCTCCTCTCTC
                      ____________________________________________________________
consensus -TTCCGCGTCAAACTACGTTACTTTACTCGCCGCCGTACTCGCTTTCTCGCTCCTCTCTC
 
. : . : . : . : . : . :
JMFF025M08- ACCCGCTGTCTCTCCTCGTTCTCCTGGCCCTCCTCGCCGCCTGGTTCTTCCTCTACCTCT
JMFN017C22- ACCCGCTGTCTCTCCTCGTTCTCCTGGCCCTCCTCGCCGCCTGGTTCTTCCTCTACCTCT
rJMFF027H21+ ACCCGCTGTCTCTCCTCGTTCTCCTGGCCCTCCTCGCCGCCTGGTTCTTCCTCTACCTCT
rJMFF025M08+ ACCCGCTGTCTCTCCTCGTTCTCCTGGCCCTCCTCGCCGCCTGGTTCTTCCTCTACCTCT
rJMFF006E18+ ACCCGCTGTCTCTCCTCGTTCTCCTGGCCCTCCTCGCCGCCTGGTTCTTCCTCTACCTCT
                      ____________________________________________________________
consensus ACCCGCTGTCTCTCCTCGTTCTCCTGGCCCTCCTCGCCGCCTGGTTCTTCCTCTACCTCT
 
. : . : . : . : . : . :
JMFF025M08- TCCGCCCGTCGGATCAGCCGGTCGTCATCTTCGGCCGCACCTTCTCCGACCGTGAAACGC
JMFN017C22- TCCGCCCGTCGGATCAGCCGGTCGTCATCTTCGGCCGCACCTTCTCCGACCGTGAAACGC
rJMFF027H21+ TCCGCCCGTCGGATCAGCCGGTCGTCATCTTCGGCCGCACCTTCTCCGACCGTGAAACGC
rJMFF025M08+ TCCGCCCGTCGGATCAGCCGGTCGTCATCTTCGGCCGCACCTTCTCCGACCGTGAAACGC
rJMFF006E18+ TCCGCCCGTCGGATCAGCCGGTCGTCATCTTCGGCCGCACCTTCTCCGACCGTGAAACGC
                      ____________________________________________________________
consensus TCCGCCCGTCGGATCAGCCGGTCGTCATCTTCGGCCGCACCTTCTCCGACCGTGAAACGC
 
. : . : . : . : . : . :
JMFF025M08- TCGGGATCTTAGTTGTGTCTACCATTG
JMFN017C22- TCGGGATCTTAGTTGTGTCTACCATTGTTGTTGTGTTCCTCACTAGCGTCGGATCGCTAC
rJMFF027H21+ TCGGGATCTTAGTTGTGTCTACCATTGTTGTCGTGTTCCTCACTAGCGTCGGATCGCTAC
rJMFF025M08+ TCGGGATCTTAGTTGTGTCTACCATTGTTGTTGTGTTCCTCACTAGCGTCGGATCGCTAC
rJMFF006E18+ TCGGGATCTTAGTTGTGTCTACCATTGTTGTCGTGTTCCTCACTAGCGTCGGATCGCTAC
                      ____________________________________________________________
consensus TCGGGATCTTAGTTGTGTCTACCATTGTTGTTGTGTTCCTCACTAGCGTCGGATCGCTAC
 
. : . : . : . : . : . :
JMFN017C22- TCATCTCCGCTCTCCTTGTCGGATTAGCTCTCGTGTGTACTCATGGAGCTNTTAGGATGC
rJMFF027H21+ TCATCTCCGCTCTCCTTGTCGGATTAGCTCTCGTGTGTACTCATGGAGCTTTTAGGATGC
rJMFF025M08+ TCATCTCCGCTCTCCTTGTCGGATTAGCTCTCGTGTGTACTCATGGAGCTTTTAGGATGC
rJMFF006E18+ TCATCTCCGCTCTCCTTGTCGGATTAGCTCTCGTGTGTACTCATGGAGCTTTTAGGATGC
                      ____________________________________________________________
consensus TCATCTCCGCTCTCCTTGTCGGATTAGCTCTCGTGTGTACTCATGGAGCTTTTAGGATGC
 
. : . : . : . : . : . :
JMFN017C22- CGGAGGACTTGTTCCTTGACGATCAGGA
rJMFF027H21+ CGGAGGACTTGTTCCTTGACGATCAGGAGCCAGCCAACGCCGGATTCCTCTCCTTTCTCG
rJMFF025M08+ CGGAGGACTTGTTCCTTGACGATCAGGAGCCAGCCAACGCCGGATTCCTCTCCTTTCTCG
rJMFF006E18+ CGGAGGACTTGTTCCTTGACGATCAGGAGCCAGCCAACGCCGGATTCCTCTCCTTTCTCG
                      ____________________________________________________________
consensus CGGAGGACTTGTTCCTTGACGATCAGGAGCCAGCCAACGCCGGATTCCTCTCCTTTCTCG
 
. : . : . : . : . : . :
rJMFF027H21+ GCGGTGCGGCCTCCACCGCAGCCGCTGCCGCTGCCCCAGCCGTCGCAACTCGCGTGTAAT
rJMFF025M08+ GCGGTGCGGCCTCCACCGCAGCCGCTGCCGCTGCCCCAGCCGTCGCAACTCGCGTGTAAT
rJMFF006E18+ GCGGTGCGGCCTCCACCGCAGCCGCTGCCGCTGCCCCAGCCGTCGCAACTCGCGTGTAAT
                      ____________________________________________________________
consensus GCGGTGCGGCCTCCACCGCAGCCGCTGCCGCTGCCCCAGCCGTCGCAACTCGCGTGTAAT
 
. : . : . : . : . : . :
rJMFF027H21+ CAGATCGCATCTGATTAGATCTCATTCAAGTGGAGAAACTCAAAGGAGGTTCGTTAAGGC
rJMFF025M08+ CAGATCGCATCTGATTAGATCTCATTCAAGTGGAGAAACTCAAAGGAGGTTCGTTAAGGC
rJMFF006E18+ CAGATCGCATCTGATTAGATCTCATTCAAGTGGAGAAACTCAAAGGAGGTTCGTTAAGGC
                      ____________________________________________________________
consensus CAGATCGCATCTGATTAGATCTCATTCAAGTGGAGAAACTCAAAGGAGGTTCGTTAAGGC
 
. : . : . : . : . : . :
rJMFF027H21+ TTCTACACATACGTGGTTAATTTGGTTACCTACTCAGATTGAACTGTGATATTAAAATGA
rJMFF025M08+ TTCTACACATACGTGGTTAATTTGGTTACCTACTCAGATTGAACTGTGATATTAAAATGA
rJMFF006E18+ TTCTACACATACGTGGTTAATTTGGTTACCTACTCAGATTGAACTGTGATATTAAAATGA
                      ____________________________________________________________
consensus TTCTACACATACGTGGTTAATTTGGTTACCTACTCAGATTGAACTGTGATATTAAAATGA
 
. : . : . : . : . : . :
rJMFF027H21+ GAAATAGCCACTGATTTTGCAGAAATTCGTTAGATACTCTGTATCTAGTTTGAATCTGTT
rJMFF025M08+ GAAATAGCCACTGATTTTGCAGAAATTCGTTAGATACTCTGTATCTAGTTTGAATCTGTT
rJMFF006E18+ GAAATAGCCACTGATTTTGCAGAAATTCGTTAGATACTCTGTATCTAGTTTGAATCTGTT
                      ____________________________________________________________
consensus GAAATAGCCACTGATTTTGCAGAAATTCGTTAGATACTCTGTATCTAGTTTGAATCTGTT
 
. : . : . : . : . : . :
rJMFF027H21+ ATCTCCTAGTTTAGATCTATATACATTTGCTATCTTTGATTTCCTGTGTCTGTATCATTA
rJMFF025M08+ ATCTCCTAGTTTAGATCTATATACATTTGCTATCTTTGATTTCCTGTGTCTGTATCATTA
rJMFF006E18+ ATCTCCTAGTTTAGATCTATATACATTTGCTATCTTTGATTTCCTGTGTCTGTATCATTA
                      ____________________________________________________________
consensus ATCTCCTAGTTTAGATCTATATACATTTGCTATCTTTGATTTCCTGTGTCTGTATCATTA
 
. : . : . : . : . : . :
rJMFF027H21+ AATCATTGATTTTCCTGATGGAGTTTGCAATCTGTTAATTGTTACATTTCAA
rJMFF025M08+ AATCATTGATTTTCCTGATGGAGTTTGCAATCTGTTAATTGTTACATTTCAA
rJMFF006E18+ AATCATTGATTTTCCTGATGGAGTTTGCAATCTGTTAATTGTTACATTTCAATATGAATC
                      ____________________________________________________________
consensus AATCATTGATTTTCCTGATGGAGTTTGCAATCTGTTAATTGTTACATTTCAATATGAATC