Previous Contig 008417:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006C17Sequence576004201 (12)pir|G96563|G96563e-112probable coatomer complex subunit, 33791-27676 [imported] - Arabidopsis thaliana773008417 (2)gb:BT006480_16393671e-35Arabidopsis thaliana At1g52360 gene, complete cds.>gb:AK118389_1816368 Arabidops
JMFS008F07Sequence614008417 (2)gb:BT006480_16393673e-72Arabidopsis thaliana At1g52360 gene, complete cds.>gb:AK118389_1816368 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS008F07- TTCTATTGCCAAGGAGCATGGGAAGAATAATGTTTC
                      ____________________________________________________________
consensus TTCTATTGCCAAGGAGCATGGGAAGAATAATGTTTC
 
. : . : . : . : . : . :
JMFS008F07- ATTCCTTTGCCTATTTCTGCTGGGTAAAGTGGATGAGTGCATTCAGCTGTTGATTGACAG
                      ____________________________________________________________
consensus ATTCCTTTGCCTATTTCTGCTGGGTAAAGTGGATGAGTGCATTCAGCTGTTGATTGACAG
 
. : . : . : . : . : . :
JMFS008F07- TGGCCGTATACCTGAAGCAGCATTTATGGCACGATCATATTTACCCAGTAAAGTCTCTGA
                      ____________________________________________________________
consensus TGGCCGTATACCTGAAGCAGCATTTATGGCACGATCATATTTACCCAGTAAAGTCTCTGA
 
. : . : . : . : . : . :
JMFS008F07- AATAGTTTCCATTTGGAGAAAGGACCTTAACAAGGTCAACCAGAAAGCTGCTGAGGCTTT
                      ____________________________________________________________
consensus AATAGTTTCCATTTGGAGAAAGGACCTTAACAAGGTCAACCAGAAAGCTGCTGAGGCTTT
 
. : . : . : . : . : . :
JMFS008F07- GGCTGATCCTCAAGAATATCCGAACTTGTTTGAGGATTGGCAAGTTGCACTTGCTGTTGA
rJMFF006C17+ TCAAGAATATCCGAACTTGTTTGAGGATTGGCAAGTTGCACTTGCTGTTGA
                      ____________________________________________________________
consensus GGCTGATCCTCAAGAATATCCGAACTTGTTTGAGGATTGGCAAGTTGCACTTGCTGTTGA
 
. : . : . : . : . : . :
JMFS008F07- ATCTAGCGTTGCAGAGACCAGAGGTATCTACCCACCAGCAGCCGAATATTTAAATCATGC
rJMFF006C17+ ATCTAGCGTTGCAGAGACCAGAGGTATCTACCCACCAGCAGCCGAATATTTAAATCATGC
                      ____________________________________________________________
consensus ATCTAGCGTTGCAGAGACCAGAGGTATCTACCCACCAGCAGCCGAATATTTAAATCATGC
 
. : . : . : . : . : . :
JMFS008F07- TGATAGATCTGCAGTCAACCTTGTGGAGGCTTTCAGGAATATGAGGATGGATGAAGAGGA
rJMFF006C17+ TGATAGATCTGCAGTCAACCTTGTGGAGGCTTTCAGGAATATGAGGATGGATGAAGAGGA
                      ____________________________________________________________
consensus TGATAGATCTGCAGTCAACCTTGTGGAGGCTTTCAGGAATATGAGGATGGATGAAGAGGA
 
. : . : . : . : . : . :
JMFS008F07- ACCCCTTGAAAATGGAGAATTGGATCATGAGGCTGCAGTACAGAATGAAGGCGAGGGACA
rJMFF006C17+ ACCCCTTGAAAATGGAGAATTGGATCATGAGGCTGCAGTACAGAATGAAGGCGAGGGACA
                      ____________________________________________________________
consensus ACCCCTTGAAAATGGAGAATTGGATCATGAGGCTGCAGTACAGAATGAAGGCGAGGGACA
 
. : . : . : . : . : . :
JMFS008F07- GCAGCCGGAGCAAGATGATATTCAACCAGAGGGGCATGAAGATGGCCAAGAAGAGGCTGT
rJMFF006C17+ GCAGCCGGAGCAAGATGATATTCAACCAGAGGGGCATGAAGATGGCCAAGAAGAGGCTGT
                      ____________________________________________________________
consensus GCAGCCGGAGCAAGATGATATTCAACCAGAGGGGCATGAAGATGGCCAAGAAGAGGCTGT
 
. : . : . : . : . : . :
JMFS008F07- TGTGGTGGATGCTGAATCAACAGATGGTGTGCTTGTTAATGGAAACGATGCTGATGAAGA
rJMFF006C17+ TGTGGTGGATGCTGAATCAACAGATGGTGTGCTTGTTAATGGAAACGATGCTGATGAAGA
                      ____________________________________________________________
consensus TGTGGTGGATGCTGAATCAACAGATGGTGTGCTTGTTAATGGAAACGATGCTGATGAAGA
 
. : . : . : . : . : . :
JMFS008F07- GTGGGGTATGAATAATGAAGGAAAACAGTCAGCTTAAA
rJMFF006C17+ GTGGGGTATGAATAATGAAGGAAAACAGTCAGCTTAAAAGCAATTGGTTGGGCTGGTGTG
                      ____________________________________________________________
consensus GTGGGGTATGAATAATGAAGGAAAACAGTCAGCTTAAAAGCAATTGGTTGGGCTGGTGTG
 
. : . : . : . : . : . :
rJMFF006C17+ AAAATCGTAGTTTTGTCGCTGTGCTTACACATCCCTGATTCCAGTCAATGCAATCGGTTC
                      ____________________________________________________________
consensus AAAATCGTAGTTTTGTCGCTGTGCTTACACATCCCTGATTCCAGTCAATGCAATCGGTTC
 
. : . : . : . : . : . :
rJMFF006C17+ CAGCTGTATGTAATTCATTCTTAAGACTCTCCGTCAATCGTCTTGAAAAGGTAAAGGTGA
                      ____________________________________________________________
consensus CAGCTGTATGTAATTCATTCTTAAGACTCTCCGTCAATCGTCTTGAAAAGGTAAAGGTGA
 
. : . : . : . : . : . :
rJMFF006C17+ AGAGGAACCGGGTGTTTGCTTGGCTTGGCTGTGGTGTGATTTTGTAGCAATGAGTTTTTT
                      ____________________________________________________________
consensus AGAGGAACCGGGTGTTTGCTTGGCTTGGCTGTGGTGTGATTTTGTAGCAATGAGTTTTTT
 
. : . : . : . : . : . :
rJMFF006C17+ CAACATTCAGTAGACGACATTTGTTTGAGCTTCAGTTATTAAATACTGTGTAGCTTAGAT
                      ____________________________________________________________
consensus CAACATTCAGTAGACGACATTTGTTTGAGCTTCAGTTATTAAATACTGTGTAGCTTAGAT
 
. : . : . : . : . : . :
rJMFF006C17+ GCCCCCCCATAGTTGTCTTAATTAATACAGTATGATATTCTTTGAAATTCTTAAATGCCA
                      ____________________________________________________________
consensus GCCCCCCCATAGTTGTCTTAATTAATACAGTATGATATTCTTTGAAATTCTTAAATGCCA
 
. : . : . : . : . : . :
rJMFF006C17+ TTGTGAATGTAGAAGTATTATGTTATATGAAAAGTGCGGATAGGGTGGATCATTTTAACC
                      ____________________________________________________________
consensus TTGTGAATGTAGAAGTATTATGTTATATGAAAAGTGCGGATAGGGTGGATCATTTTAACC