Previous Contig 008413:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006A19Sequence485008413 (7)gb:CQ785706_14527655e-28Sequence 19 from Patent WO2004018687.723008413 (7)gb:CQ785706_14527651e-40Sequence 19 from Patent WO2004018687.
JMFF028B06Sequence501008413 (7)gb:CQ785706_14527655e-32Sequence 19 from Patent WO2004018687.706008413 (7)gb:CQ785706_14527651e-40Sequence 19 from Patent WO2004018687.
JMFN019C06Sequence641008413 (7)gb:CQ785706_14527651e-40Sequence 19 from Patent WO2004018687.
JMFN030M11Sequence611008413 (7)gb:CQ785706_14527651e-40Sequence 19 from Patent WO2004018687.
JMSF011G18Sequence404008413 (7)gb:CQ785706_14527653e-17Sequence 19 from Patent WO2004018687.805022426gb:OSJN00244_16972821e-42Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0053B21, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006A19- CTC
                      ____________________________________________________________
consensus CTC
 
. : . : . : . : . : . :
rJMFF028B06- TTTGGTTTTTTGATTGGATTTCACAGAATACCGTAGTTTATACACTGGAATTGGGATAAA
JMFN019C06+ GATAAA
JMFN030M11+ CGTAGTTTATACACTGGAATTGGGATAAA
rJMFF006A19- TTTGGTTTTTTGATTGGATTTCACAGAATACCGTAGTTTATACACTGGAATTGGGATAAA
                      ____________________________________________________________
consensus TTTGGTTTTTTGATTGGATTTCACAGAATACCGTAGTTTATACACTGGAATTGGGATAAA
 
. : . : . : . : . : . :
rJMFF028B06- AATGCAACAACCATTAAACAATCGACTTTCTTGCAAGTCTGCAATAGCTTCTGCATCTAA
JMFN019C06+ AATGCAACAACCATTAAACAATCGACTTTCTTGCAAGTCTGCAATAGCTTCTGCATCTAA
JMFN030M11+ AATGCAACAACCATTAAACAATCGACTTTCTTGCAAGTCTGCAATAGCTTCTGCATCTAA
rJMFF006A19- AATGCAACAACCATTAAACAATCGACTTTCTTGCAAGTCTGCAATAGCTTCTGCATCTAA
                      ____________________________________________________________
consensus AATGCAACAACCATTAAACAATCGACTTTCTTGCAAGTCTGCAATAGCTTCTGCATCTAA
 
. : . : . : . : . : . :
rJMFF028B06- GAAAGCTTTATGCTTTTCTGGCATTAGCTTCTGATAGCAAATTCTCGAGTTCTCCTTTCT
JMFN019C06+ GAAAGCTTTATGCTTTTCTGGCATTAGCTTCTGATAGCAAATTCTCGAGTTCTCCTTTCT
JMFN030M11+ GAAAGCTTTATGCTTTTCTGGCATTAGCTTCTGATAGCAAATTCTCGAGTTCTCCTTTCT
rJMFF006A19- GAAAGCTTTATGCTTTTCTGGCATTAGCTTCTGATAGCAAATTCTCGAGTTCTCCTTTCT
                      ____________________________________________________________
consensus GAAAGCTTTATGCTTTTCTGGCATTAGCTTCTGATAGCAAATTCTCGAGTTCTCCTTTCT
 
. : . : . : . : . : . :
rJMFF028B06- GATACAGCTCGATGGTATCTGAACAACCACCGATATGTTTGCCCCCAATGAACACATTAG
JMFN019C06+ GATACAGCTCGATGGTATCTGAACAACCACCGATATGTTTGCCCCCAATGAACACATTAG
JMFN030M11+ GATACAGCTCGATGGTATCTGAACAACCACCGATATGTTTGCCCCCAATGAACACATTAG
JMFF028B06+ ACCACCGATATGTTTGCCCCCAATGAACACATTAG
JMFF006A19+ CCCCCAATGAACACATTAG
rJMFF006A19- GATACAGCTCGATGGTATCTGAACAACCACCGATATGTTTGCCCCCAATGAACACATTAG
                      ____________________________________________________________
consensus GATACAGCTCGATGGTATCTGAACAACCACCGATATGTTTGCCCCCAATGAACACATTAG
 
. : . : . : . : . : . :
rJMFF028B06- GAACAGTACGCTGTCCAGTGAGACCTTCCAGCACCTTCTGAATTTGCGATCCTTGCTGAC
JMFN019C06+ GAACAGTACGCTGTCCAGTGAGACCTTCCAGCACCTTCTGAATTTGCGATCCTTGCTGAC
JMFN030M11+ GAACAGTACGCTGTCCAGTGAGACCTTCCAGCACCTTCTGAATTTGCGATCCTTGCTGAC
JMFF028B06+ GAACAGTACGCTGTCCAGTGAGACCTTCCAGCACCTTCTGAATTTGCGATCCTTGCTGAC
JMSF011G18+ TGCGATCCTTGCTGAC
JMFF006A19+ GAACAGTACGCTGTCCAGTGAGACCTTCCAGCACCTTCTGAATTTGCGATCCTTGCTGAC
rJMFF006A19- GAACAGTACGCTGTCCAGTGAGACCTTCCAGCACCTTCTGAATTTGCGATCCTTGCTGAC
                      ____________________________________________________________
consensus GAACAGTACGCTGTCCAGTGAGACCTTCCAGCACCTTCTGAATTTGCGATCCTTGCTGAC
 
. : . : . : . : . : . :
rJMFF028B06- CCATTTGGTCCAATTCAACAACAAGTGGATCCAAGCCAAGCCTTCTGAACAAAGATTTCA
JMFN019C06+ CCATTTGGTCCAATTCAACAACAAGTGGATCCAAGCCAAGCCTTCTGAACAAAGATTTCA
JMFN030M11+ CCATTTGGTCCAATTCAACAACAAGTGGATCCAAGCCAAGCCTTCTGAACAAAGATTTCA
JMFF028B06+ CCATTTGGTCCAATTCAACAACAAGTGGATCCAAGCCAAGCCTTCTGAACAAAGATTTCA
JMSF011G18+ CCATTTGGTCCAATTCAACAACAAGTGGATCCAAGCCAAGCCTTCTGAACAAAGATTTCA
JMFF006A19+ CCATTTGGTCCAATTCAACAACAAGTGGATCCAAGCCAAGCCTTCTGAACAAAGATTTCA
rJMFF006A19- CCATTTGGTCCAATTCAACAACAAGTGGATCCAAGCCAAGCCTTCTGAACAAAGATTTCA
                      ____________________________________________________________
consensus CCATTTGGTCCAATTCAACAACAAGTGGATCCAAGCCAAGCCTTCTGAACAAAGATTTCA
 
. : . : . : . : . : . :
rJMFF028B06- CCTGACCCGAGTACGAGCACCAAGTTTTGGAGTAGACAACGACTGGGTTCTCGCTGACGG
JMFN019C06+ CCTGACCCGAGTACGAGCACCAAGTTTTGGAGTAGACAACGACTGGGTTCTCGCTGACGG
JMFN030M11+ CCTGACCCGAGTACGAGCACCAAGTTTTGGAGTAGACAACGACTGGGTTCTCGCTGACGG
JMFF028B06+ CCTGACCCGAGTACGAGCACCAAGTTTTGGAGTAGACAACGACTGGGTTCTCGCTGACGG
JMSF011G18+ CCTGACCCGAGTACGAGCACCAAGTTTTGGAGTAGACAACGACTGGGTTCTCGCTGACGG
JMFF006A19+ CCTGACCCGAGTACGAGCACCAAGTTTTGGAGTAGACAACGACTGGGTTCTCGCTGACGG
rJMFF006A19- CCTGACCCGAGTACGAGCACCAAGTTTTGGAGTAGACAACGACTGGGTTCTCGCTGACGG
                      ____________________________________________________________
consensus CCTGACCCGAGTACGAGCACCAAGTTTTGGAGTAGACAACGACTGGGTTCTCGCTGACGG
 
. : . : . : . : . : . :
rJMFF028B06- TCTTCTTCACGCTGTCCTCCAAGCCGGAGGAGCTGGACGAATCCGACATGGCGCGAATCA
JMFN019C06+ TCTTCTTCACGCTGTCCTCCAAGCCGGAGGAGCTGGACGAATCCGACATGGCGCGAATCA
JMFN030M11+ TCTTCTTCACGCTGTCCTCCAAGCCGGAGGAGCTGGACGAATCCGACATGGCGCGAATCA
JMFF028B06+ TCTTCTTCACGCTGTCCTCCAAGCCGGAGGAGCTGGACGAATCCGACATGGCGCGAATCA
JMSF011G18+ TCTTCTTCACGCTGTCCTCCAAGCCGGAGGAGCTGGACGAATCCGACATGGCGCGAATCA
JMFF006A19+ TCTTCTTCACGCTGTCCTCCAAGCCGGAGGAGCTGGACGAATCCGACATGGCGCGAATCA
rJMFF006A19- TCTTCTTCACGCTGTCCTCCAAGCCGGAGGAGCTGGACGAATCCGACATGGCGCGAATCA
                      ____________________________________________________________
consensus TCTTCTTCACGCTGTCCTCCAAGCCGGAGGAGCTGGACGAATCCGACATGGCGCGAATCA
 
. : . : . : . : . : . :
rJMFF028B06- GGGTAGGCGCCCGTTTTCGGTGGACACATTTCGCGAGACTCGTTAAGCTTCTGCTGCGTA
JMFN019C06+ GGGTAGGCGCCCGTTTTCGGTGGACACATTTCGCGAGACTCGTTAAGCTTCTGCTGCGTA
JMFN030M11+ GGGTAGGCGCCCGTTTTCGGTGGACACATTTCGCGAGACTCGTTAAGCTTCTGCTGCGTA
JMFF028B06+ GGGTAGGCGCCCGTTTTCGGTGGACACATTTCGCGAGACTCGTTAAGCTTCTGCTGCGTA
JMSF011G18+ GGGTAGGCGCCCGTTTTCGGTGGACACATTTCGCGAGACTCGTTAAGCTTCTGCTGCGTA
JMFF006A19+ GGGTAGGCGCCCGTTTTCGGTGGACACATTTCGCGAGACTCGTTAAGCTTCTGCTGCGTA
rJMFF006A19- GGGTAGGCGCCCGTTTTCGGTGGACACATTTCGCGAGACTCGTTAAGCTTCTGCTGCGTA
                      ____________________________________________________________
consensus GGGTAGGCGCCCGTTTTCGGTGGACACATTTCGCGAGACTCGTTAAGCTTCTGCTGCGTA
 
. : . : . : . : . : . :
rJMFF028B06- ATCTGATGTTTCGATTGTCGCGATTGCAAAGCGCAGATGGGTTACGGGAAGGCAAGAGAG
JMFN019C06+ ATCTGATGTTTCGATTGTCGCGATTGCAAAGCGCAGATGGGTTACGGGAAGGCAAGAGAG
JMFN030M11+ ATCTGATGTTTCGATTGTCGCGATTGCAAAGCGCAGATGGGTTACGGGAAGGCAAGAGAG
JMFF028B06+ ATCTGATGTTTCGATTGTCGCGATTGCAAAGCGCAGATGGGTTACGGGAAGGCAAGAGAG
JMSF011G18+ ATCTGATGTTTCGATTGTCGCGATTGCAAAGCGCAGATGGGTTACGGGAAGGCAAGAGAG
JMFF006A19+ ATCTGATGTTTCGATTGTCGCGATTGCAAAGCGCAGATGGGTTACGGGAAGGCAAGAGAG
rJMFF006A19- ATCTGATGTTTCGATTGTCGCGATTGCAAAGCGCAGATGGGTTACGGGAAGGCAAGAGAG
                      ____________________________________________________________
consensus ATCTGATGTTTCGATTGTCGCGATTGCAAAGCGCAGATGGGTTACGGGAAGGCAAGAGAG
 
. : . : . : . : . : . :
rJMFF028B06- GGCGAAGGGAAGACGTTAGTGATAAGGAAGCCATGCCTCTAGTCATAGCCATAGTTGTAG
JMFN019C06+ GGCGAAGGGAAGACGTTAGTGATAAGGAAGCCATGCCTCTAGTCATAGCCATAGTTGTAG
JMFN030M11+ GGCGAAGGGAAGACGTTAGTGATAAGGAAGCCATGCCTCTAG
JMFF028B06+ GGCGAAGGGAAGACGTTAGTGATAAGGAAGCCATGCCTCTAGTCATAGCCATAGTTGTAG
JMSF011G18+ GGCGAAGGGAAGACGTTAGTGATAAGGAAGCCATGCCTCTAGTCATAGCCATAGTTGTAG
JMFF006A19+ GGCGAAGGGAAGACGTTAGTGATAAGGAAGCCATGCCTCTAGTCATAGCCATAGTTGTAG
rJMFF006A19- GGCGAAGGGAAGACGTTAGTGATAAGGAAGCCATGCCTCTAGTCATAGCCATAGTTGTAG
                      ____________________________________________________________
consensus GGCGAAGGGAAGACGTTAGTGATAAGGAAGCCATGCCTCTAGTCATAGCCATAGTTGTAG
 
. : . : . : . : . : . :
rJMFF028B06- TTGCAGGCGTACCCGCCATTGTTACCTAACTCAGATTGGTTTTTCT
JMFN019C06+ TTGCAGGCGTACCCGCCATTGTTACCTAACTCAGA
JMFF028B06+ TTGCAGGCGTACCCGCCATTGTTACCTAACTCAGATTGGTTTTTCT
JMSF011G18+ TTGCAGGCGTACCCGCCATTGTTACC
JMFF006A19+ TTGCAGGCGTACCCGCCATTGTTACCTAACTCAGATTGGTTTTTCT
rJMFF006A19- TTGCAGGCGTACCCGCCATTGTTACCTAACTCAGATTGGNTTTTCTCGGTTCTCGACGAA
                      ____________________________________________________________
consensus TTGCAGGCGTACCCGCCATTGTTACCTAACTCAGATTGGTTTTTCTCGGTTCTCGACGAA