Previous Contig 008407:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005P19Sequence402008407 (6)gb:AY087298_15723313e-12Arabidopsis thaliana clone 33791 mRNA, complete sequence.652008407 (6)gb:AB013388_15120283e-10Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E1.
JMSF010G20Sequence361008407 (6)gb:AY087298_15723313e-11Arabidopsis thaliana clone 33791 mRNA, complete sequence.794008407 (6)gb:AB013388_15120283e-25Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E1.
JMSF038F19Sequence687008407 (6)gb:AB013388_15120283e-43Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E1.848008407 (6)gb:AB013388_15120281e-37Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E1.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF010G20- GTCTTTTCCTCC
JMFF005P19- AGAAAATACAGAAAACAGTTGTATTCCGGAGGATTGTTTGTCCTCGTCTTTTCCTCC
JMSF038F19- GTCTTTTCCTCC
                      ____________________________________________________________
consensus AGAAAATACAGAAAACAGTTGTATTCCGGAGGATTGTTTGTCCTCGTCTTTTCCTCC
 
. : . : . : . : . : . :
JMSF010G20- ATGAAATGGGAAATGGAGGTGGAAGAGAAAGAGATCGAAGTTGTGCTGGAGAAAATTTGG
JMFF005P19- ATGAAATGGGAAATGGAGGTGGAAGAGAAAGAGATCGAAGTTGTGCTGGAGAAAATTTGG
JMSF038F19- ATGAAATGGGAAATGGAGGTGGAAGAGAAAGAGATCGAAGTTGTGCTGGAGAAAATTTGG
                      ____________________________________________________________
consensus ATGAAATGGGAAATGGAGGTGGAAGAGAAAGAGATCGAAGTTGTGCTGGAGAAAATTTGG
 
. : . : . : . : . : . :
JMSF010G20- GATTTGCACGATAAGTTTAGCGACGCAATTCACTCCATCTCCCGAGCTCACTTCCTCAGC
JMFF005P19- GATTTGCACGATAAGTTTAGCGACGCAATTCACTCCATCTCCCGAGCTCACTTCCTCAGC
JMSF038F19- GATTTGCACGATAAGTTTAGCGACGCAATTCACTCCATCTCCCGAGCTCACTTCCTCAGC
                      ____________________________________________________________
consensus GATTTGCACGATAAGTTTAGCGACGCAATTCACTCCATCTCCCGAGCTCACTTCCTCAGC
 
. : . : . : . : . : . :
JMSF010G20- TCCGTCAAGTCTCGCGGCAAAACCGAGGATTTCCACTTTCCCCACCGGCCAAGGAAGAAG
JMFF005P19- TCCGTCAAGTCTCGCGGCAAAACCGAGGATTTCCACTTTCCCCACCGGCCAAGGAAGAAG
JMSF038F19- TCCGTCAAGTCTCGCGGCAAAACCGAGGATTTCCACTTTCCCCACCGGCCAAGGAAGAAG
                      ____________________________________________________________
consensus TCCGTCAAGTCTCGCGGCAAAACCGAGGATTTCCACTTTCCCCACCGGCCAAGGAAGAAG
 
. : . : . : . : . : . :
JMSF010G20- CCGGAGGCGGATTCCTATCAGAGAGCGCACAATAAAGAAGTTAGGAACGACGGAAACAAG
JMFF005P19- CCGGAGGCGGATTCCTATCAGAGAGCGCACAATAAAGAAGTTAGGAACGACGGAAACAAG
JMSF038F19- CCGGAGGCGGATTCCTATCAGAGAGCGCACAATAAAGAAGTTAGGAACGACGGAAACAAG
                      ____________________________________________________________
consensus CCGGAGGCGGATTCCTATCAGAGAGCGCACAATAAAGAAGTTAGGAACGACGGAAACAAG
 
. : . : . : . : . : . :
JMSF010G20- GCTTCCGGGTTCGTCTTTGTGAAGGAGTTCCGAGTTGGCGATGAGGATGACTCGGCTGCG
JMFF005P19- GCTTCCGGGTTCGTCTTTGTGAAGGAGTTCCGAGTTGGCGATGAGGATGACTCGGCTGCG
JMSF038F19- GCTTCCGGGTTCGTCTTTGTGAAGGAGTTCCGAGTTGGCGATGAGGATGACTCGGCTGCG
                      ____________________________________________________________
consensus GCTTCCGGGTTCGTCTTTGTGAAGGAGTTCCGAGTTGGCGATGAGGATGACTCGGCTGCG
 
. : . : . : . : . : . :
JMSF010G20- GTTCGTGAAGCTAAGAGCCTAAACGCCATCCGAACCGCCC
JMFF005P19- GTTCGTGAAGCTAAGAGCCTAAACGCCATCCGAACCGCCC
JMSF038F19- GTTCGTGAAGCTAAGAGCCTAAACGCCATCCGAACCGCCCTCGAAAACCTCGAAGACCAG
rJMSF038F19+ GCCCTCGAAAACCTCGAAGACCAG
                      ____________________________________________________________
consensus GTTCGTGAAGCTAAGAGCCTAAACGCCATCCGAACCGCCCTCGAAAACCTCGAAGACCAG
 
. : . : . : . : . : . :
JMSF038F19- CTCGAATTCCTCCATACCATGCAAACGCATCAACGGGCAGAGAGAGATGTTGTGCTTGCT
rJMSF038F19+ CTCGAATTCCTCCATACCATGCAAACGCATCAACGGGCAGAGAGAGATGTTGTGCTTGCT
rJMSF010G20+ CAACNGGCAGAGAGAGATGTTGTGC-TGCT
                      ____________________________________________________________
consensus CTCGAATTCCTCCATACCATGCAAACGCATCAACGGGCAGAGAGAGATGTTGTGCTTGCT
 
. : . : . : . : . : . :
JMSF038F19- CGCATAGAACAAAGCCGCATTCTCCTTGCATTGAGATTGGCAGAGCATCAGGGTAAAAGG
rJMSF038F19+ CGCATAGAACAAAGCCGCATTCTCCTTGCATTGAGATTGGCAGAGCATCAGGGTAAAAGG
rJMSF010G20+ CGCATAGAACAAAGCCGCATTCTCCNTGCATTGAGATTGGCAGAGCATCAGGGTAAAAGG
                      ____________________________________________________________
consensus CGCATAGAACAAAGCCGCATTCTCCTTGCATTGAGATTGGCAGAGCATCAGGGTAAAAGG
 
. : . : . : . : . : . :
JMSF038F19- TATAAATGTATAGAAGAAGCTCAAGCACTGGTTTGTGATGTTAAGGATGCCAGTCATTTC
rJMSF038F19+ TATAAATGTATAGAAGAAGCTCAAGCACTGGTTTGTGATGTTAAGGATGCCAGTCATTTC
rJMSF010G20+ TATAAATGTATAGAAGAAGCTCAAGCACTGGTTTGTGATGTTAAGGATGCCAGTCATTTC
                      ____________________________________________________________
consensus TATAAATGTATAGAAGAAGCTCAAGCACTGGTTTGTGATGTTAAGGATGCCAGTCATTTC
 
. : . : . : . : . : . :
JMSF038F19- GTTTCACCTGAAAGCCTTTCTGGTAATGCACACTGTGAGGATTTTGTTGCACGGGATGGG
rJMSF038F19+ GTTTCACCTGAAAGCCTTTCTGGTAATGCACACTGTGAGGATTTTGTTGCACGGGATGGG
rJMSF010G20+ GTTTCACCTGAAAGCCTTTCTGGTAATGCACACTGTGAGGATTTTGTTGCACGGGATGGG
rJMFF005P19+ TGAAAGCCTTTCTGGTAATGCACACTGTGAGGATTTTGTTGCACGGGATGGG
                      ____________________________________________________________
consensus GTTTCACCTGAAAGCCTTTCTGGTAATGCACACTGTGAGGATTTTGTTGCACGGGATGGG
 
. : . : . : . : . : . :
JMSF038F19- AAGAGATCAAATGTGTTTCTTAATGTTCTCTTTTCTAGTTTCAATTTCGTCAAGCAGTCC
rJMSF038F19+ AAGAGATCAAATGTGTTTCTTAATGTTCTCTTTTCTAGTTTCAATTTCGTCAAGCAGTCC
rJMSF010G20+ AAGAGATCAAATGTGTTTCTTAATGTTCTCTTTTCTAGTTTCAATTTCGTCAAGCAGTCC
rJMFF005P19+ AAGAGATCAAATGTGTTTCTTAATGTTCTCTTTTCTAGTTTCAATTTCGTCAAGCAGTCC
                      ____________________________________________________________
consensus AAGAGATCAAATGTGTTTCTTAATGTTCTCTTTTCTAGTTTCAATTTCGTCAAGCAGTCC
 
. : . : . : . : . : . :
rJMSF038F19+ CTTAGACTAGATCATGTGGGTGGGGTGCTTGGAAACGCAGCCCTGGTTGCAATTAGTATG
rJMSF010G20+ CTTAGACTAGATCATGTGGGTGGGGTGCTTGGAAACGCAGCCCTGGTTGCAATTAGTATG
rJMFF005P19+ TTTAGACTAGATCATGTGGGTGGGGTGCTTGGAAACGCAGCCCTGGTTGCAATTAGTATG
                      ____________________________________________________________
consensus CTTAGACTAGATCATGTGGGTGGGGTGCTTGGAAACGCAGCCCTGGTTGCAATTAGTATG
 
. : . : . : . : . : . :
rJMSF038F19+ CTAGCATTAATGCATCTGCAACAAGCAGGTTGCAAAGAAAAATTCGTTTTGGCCCTTCCA
rJMSF010G20+ CTAGCATTAATGCATCTGCAACAAGCAGGTTGCAAAGAAAAATTCGTTTTGGCCCTTCCA
rJMFF005P19+ CTAGCATTAATGCATCTGCAACAAGCAGGTTGCAAAGAAAAATTCGTTTTGGCCCTTCCA
                      ____________________________________________________________
consensus CTAGCATTAATGCATCTGCAACAAGCAGGTTGCAAAGAAAAATTCGTTTTGGCCCTTCCA
 
. : . : . : . : . : . :
rJMSF038F19+ CAAAGACACGAAGATGTTATCTACAACAGAAATCTGACCAAAGTCTCTCAACCCACAGGT
rJMSF010G20+ CAAAGACACGAAGATGTTATCTACAACAGAAATCTGACCAAAGTCTCTCAACCCACAGGT
rJMFF005P19+ CAAAGACACGAAGATGTTATCTACAACAGAAATCTGACCAAAGTCTCTCAACCCACAGGT
                      ____________________________________________________________
consensus CAAAGACACGAAGATGTTATCTACAACAGAAATCTGACCAAAGTCTCTCAACCCACAGGT
 
. : . : . : . : . : . :
rJMSF038F19+ TCATCATCTAGTCGTTTGTCAGAGTTGAACGTGTTGTCAGCTAGGGGCTAGACTGAAAAT
rJMSF010G20+ TCATCATCTAGTCGTTTGTCAGAGTTGAACGTGTTGTCAGCTAGGGGCTAGACTGAAAAT
rJMFF005P19+ TCATCATCTAGTCGTTTGTCAGAGTTGAACGTGTTGTCAGCTAGGGGCTAGACTGAAAAT
                      ____________________________________________________________
consensus TCATCATCTAGTCGTTTGTCAGAGTTGAACGTGTTGTCAGCTAGGGGCTAGACTGAAAAT
 
. : . : . : . : . : . :
rJMSF038F19+ AATATTATAAACTCTTTTCTCTTCTTGGGTTGACTGGATGAGTTGCTTCAAATGTTGTTA
rJMSF010G20+ AATATTATAAACTCTTTTCTCTTCTTGGGTTGACTGGATGAGTTGCTTCAAATGTTGTTA
rJMFF005P19+ AATATTATAAACTCTTTTCTCTTCTTGGGTTGACTGGATGAGTTGCTTCAAATGTTGTTA
                      ____________________________________________________________
consensus AATATTATAAACTCTTTTCTCTTCTTGGGTTGACTGGATGAGTTGCTTCAAATGTTGTTA
 
. : . : . : . : . : . :
rJMSF038F19+ ATTCGGTAGAGAGAGGCTGCATATGTGATGACAAATACCCAAATAGGTTAAGCCTAGGAA
rJMSF010G20+ ATTCGGTAGAGAGAGGCTGCATATGTGATGACAAATACCCAAATAGGTTAAGCCTAGGAA
rJMFF005P19+ ATTCGGTAGAGAGAGGCTGCATATGTGATGACAAATACCCAAATAGGTTAAGCCTAGGAA
                      ____________________________________________________________
consensus ATTCGGTAGAGAGAGGCTGCATATGTGATGACAAATACCCAAATAGGTTAAGCCTAGGAA
 
. : . : . : . : . : . :
rJMSF038F19+ TTTTCATCATCTTGAGTATCGAAATGATGCATTGATTGTTATTCTCTTTGGTGATACAAT
rJMSF010G20+ TTTTCATCATCTTGAGTATCGAAATGATGCATTGATTGTTATTCTCTTTGGTGATACAAT
rJMFF005P19+ TTTTCATCATCTTGAGTATCGAAATGATGCATTGATTGTTATTCTCTTTGGTGATACAAT
                      ____________________________________________________________
consensus TTTTCATCATCTTGAGTATCGAAATGATGCATTGATTGTTATTCTCTTTGGTGATACAAT
 
. : . : . : . : . : . :
rJMSF038F19+ GTCAGTCCGGTCCTTTCCACTACACAGCAAGATTTCATTGTATATAACTATAAACTTTCA
rJMSF010G20+ GTCAGTCCGGTCCTTTCCACTACACAGCAAGATTTCATTGTATATAACTATAAACTTTCA
rJMFF005P19+ GTCAGTCCGGTCCTTTCCACTACACAGCAAGATTTCATTGTATATAACTATAAACTTTCA
                      ____________________________________________________________
consensus GTCAGTCCGGTCCTTTCCACTACACAGCAAGATTTCATTGTATATAACTATAAACTTTCA
 
. : . : . : . : . : . :
rJMSF038F19+ TTCATTTGTATCTGTGCGAAACGTGCAACTCTTTATGTATGCAG
rJMSF010G20+ TTCATTTGTATCTGTGCGAAACGTGCAACTCTTTATGTATGCAG
rJMFF005P19+ TTCATTTGTATCTGTGCGAAACGTGCAACTCTTTATGTATGCAGGTAACAGTTGATTTAT
                      ____________________________________________________________
consensus TTCATTTGTATCTGTGCGAAACGTGCAACTCTTTATGTATGCAGGTAACAGTTGATTTAT