Previous Contig 008404:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005P09Sequence753008404 (4)gb:AP004865_18462234e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P002
JMFF035L24Sequence590005714 (3)gb:BT015363_16421913e-23Arabidopsis thaliana At1g33360 gene, complete cds.>gb:BT015893_1642511 Arabidops693008404 (4)gb:AP004865_18462236e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P002
JMSF017N01Sequence237005714 (3)779008404 (4)gb:AP004865_18462233e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P002
JMSF037O13Sequence465005714 (3)gb:AP004865_18462238e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P002653008404 (4)gb:AP004865_18462231e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P002

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF017N01+ CGCAAGTACGTGCCAACATGAGAACTGGTAGAGTAACTGATGCTG
                      ____________________________________________________________
consensus CGCAAGTACGTGCCAACATGAGAACTGGTAGAGTAACTGATGCTG
 
. : . : . : . : . : . :
rJMSF017N01+ GTGTGACATCATCTTTACTAGAAACTGTTGAGAGCAGTGATCTGATTGCATATGGCCTTA
rJMFF005P09+ GTTGAGAGCAGTGATCTGATTGCATATGNCCTTA
                      ____________________________________________________________
consensus GTGTGACATCATCTTTACTAGAAACTGTTGAGAGCAGTGATCTGATTGCATATGGCCTTA
 
. : . : . : . : . : . :
rJMSF017N01+ TTCCAGAGTTTATCGGGCGCTTCCCTATTTTAGTTAGTTTGTCAGCACTTACTGAGAACC
rJMSF037O13+ AGTTTGTCAGCACTTACTGAGAACC
rJMFF035L24+ ATTTTAGTTAGTTTGTCAGCACTTACTGAGAACC
rJMFF005P09+ TTCCAGAGTTTATCGGGCGCTTCCCTATTTTAGTTAGTTTGTCAGCACTTACTGAGAACC
                      ____________________________________________________________
consensus TTCCAGAGTTTATCGGGCGCTTCCCTATTTTAGTTAGTTTGTCAGCACTTACTGAGAACC
 
. : . : . : . : . : . :
rJMSF017N01+ AACTTGTT-CAGGTCCTCGTAGACCCAAAAAATGCTCTTTGCAAGCAGTACAAGAAATTG
rJMSF037O13+ AACTTGTT-CAGGTCCTCGTAGACCCAAAAAATGCTCTTTGCAAGCAGTACAAGAAATTG
rJMFF035L24+ AACTTGTT-CAGGTCCTCGTAGACCCAAAAAATGCTCTTTGCAAGCAGTACAAGAAATTG
rJMFF005P09+ AACTTGTTCCAGGTCCTCGTAGACCCAAAAAATGCTCTTTGCAAGCAGTACAAGAAATTG
                      ____________________________________________________________
consensus AACTTGTT-CAGGTCCTCGTAGACCCAAAAAATGCTCTTTGCAAGCAGTACAAGAAATTG
 
. : . : . : . : . : . :
rJMSF017N01+ TTTAACATGAACAAAGTGAAGCTACAATTTACAGACGAGGCGTTGAGGTTAATTGCGAAG
rJMSF037O13+ TTTAACATGAACAAAGTGAAGCTACAATTTACAGACGAGGCGTTGAGGTTAATTGCGAAG
rJMFF035L24+ TTTAACATGAACAAAGTGAAGCTACAATTTACAGACGAGGCGTTGAGGTTAATTGCGAAG
rJMFF005P09+ TTTAACATGAACAAAGTGAAGCTACAATTTACAGACGAGGCGTTGAGGTTAATTGCGAAG
                      ____________________________________________________________
consensus TTTAACATGAACAAAGTGAAGCTACAATTTACAGACGAGGCGTTGAGGTTAATTGCGAAG
 
. : . : . : . : . : . :
rJMSF017N01+ AAAGCGTATGCTAAAAACACCGGCGCAAGAGGGTTAAGAGCCATACTGGAGAGCATATTA
rJMSF037O13+ AAAGCGTATGCTAAAAACACCGGCGCAAGAGGGTTAAGAGCCATACTGGAGAGCATATTA
rJMFF035L24+ AAAGCGTATGCTAAAAACACCGGCGCAAGAGGGTTAAGAGCCATACTGGAGAGCATATTA
rJMFF005P09+ AAAGCGTATGCTAAAAACACCGGCGCAAGAGGGTTAAGAGCCATACTGGAGAGCATATTA
                      ____________________________________________________________
consensus AAAGCGTATGCTAAAAACACCGGCGCAAGAGGGTTAAGAGCCATACTGGAGAGCATATTA
 
. : . : . : . : . : . :
rJMSF017N01+ ACTGATGCTATGTATGAGATTCCTGAAGTTAAGGCAGGGAACGAGAAAGTAGATGCTGTT
rJMSF037O13+ ACTGATGCTATGTATGAGATTCCTGAAGTTAAGGCAGGGAACGAGAAAGTAGATGCTGTT
rJMFF035L24+ ACTGATGCTATGTATGAGATTCCTGAAGTTAAGGCAGGGAACGAGAAAGTAGATGCTGTT
rJMFF005P09+ ACTGATGCTATGTATGAGATTCCTGAAGTTAAGGCAGGGAACGAGAAAGTAGATGCTGTT
                      ____________________________________________________________
consensus ACTGATGCTATGTATGAGATTCCTGAAGTTAAGGCAGGGAACGAGAAAGTAGATGCTGTT
 
. : . : . : . : . : . :
rJMSF017N01+ GTGGTTGATGAAGAGTCGGTGGGTAGCGCAAGCGTCCCTGGATGTGGTGGTAAATTACTC
rJMSF037O13+ GTGGTTGATGAAGAGTCGGTGGGTAGCGCAAGCGTCCCTGGATGTGGTGGTAAATTACTC
rJMFF035L24+ GTGGTTGATGAAGAGTCGGTGGGTAGCGCAAGCGTCCCTGGATGTGGTGGTAAATTACTC
rJMFF005P09+ GTGGTTGATGAAGAGTCGGTGGGTAGCGCAAGCGTCCCTGGATGTGGTGGTAAATTACTC
                      ____________________________________________________________
consensus GTGGTTGATGAAGAGTCGGTGGGTAGCGCAAGCGTCCCTGGATGTGGTGGTAAATTACTC
 
. : . : . : . : . : . :
rJMSF017N01+ TTTGGAAATGGTGCTTTGGAGCAATACCTTGCTCGTAATCAGTCTAAAGATCAAAAGGAA
rJMSF037O13+ TTTGGAAATGGTGCTTTGGAGCAATACCTTGCTCGGAATCAGTCTAAAGATCAAAAGGAA
rJMFF035L24+ TTTGGAAATGGTGCTTTGGAGCAATACCTTGCTCGGAATCAGTCTAAAGATCAAAAGGAA
rJMFF005P09+ TTTGGAAATGGTGCTTTGGAGCAATACCTTGCTCGGAATCAGTCTAAAGATCAAAAGGAA
                      ____________________________________________________________
consensus TTTGGAAATGGTGCTTTGGAGCAATACCTTGCTCGGAATCAGTCTAAAGATCAAAAGGAA
 
. : . : . : . : . : . :
rJMSF017N01+ ATTGCTGAATCGGAACTGCAAGATGGTGGTGTTTCAGAAGTTTCATCAAGAGCAATGAGC
rJMSF037O13+ ATTGCTGAATCGGAACTGCAAGATGGTGGTGTTTCAGAAGTTTCATCAAGAGCAATGAGC
rJMFF035L24+ ATTGCTGAATCGGAACTGCAAGATGGTGGTGTTTCAGAAGTTTCATCAAGAGCAATGAGC
rJMFF005P09+ ATTGCTGAATCGGAACTGCAAGATGGTGGTGTTTCAGAAGTTTCATCAAGAGCAATGAGC
                      ____________________________________________________________
consensus ATTGCTGAATCGGAACTGCAAGATGGTGGTGTTTCAGAAGTTTCATCAAGAGCAATGAGC
 
. : . : . : . : . : . :
rJMSF017N01+ ATATAACATTAACAGAATCAGATTTTGTAATTTGTAGTATTTCTGTCTATATAAATTGTT
rJMSF037O13+ ATATAACATTAACAGAATCAGATTTTGTAATTTGTAGTATTTCTGTCTATATAAATTGTT
rJMFF035L24+ ATATAACATTAACAGAATCAGATTTTGTAATTTGTAGTATTTCTGTCTATATAAATTGTT
rJMFF005P09+ ATATAACATTAACAGAATCAGATTTTGTAATTTGTAGTATTTCTGTCTATATAAATTGTT
                      ____________________________________________________________
consensus ATATAACATTAACAGAATCAGATTTTGTAATTTGTAGTATTTCTGTCTATATAAATTGTT
 
. : . : . : . : . : . :
rJMSF017N01+ GTAAATTTTGCATCCATACTAGTTGTATTGATCCAATTGTAACACAATATAGGGCATCTA
rJMSF037O13+ GTAAATTTTGCATCCATACTAGTTGTATTGATCCAATTGTAACACAATATAGGGCATCTA
rJMFF035L24+ GTAAATTTTGCATCCATACTAGTTGTATTGATCCAATTGTAACACAATATAGGGCATCTA
rJMFF005P09+ GTAAATTTTGCATCCATACTAGTTGTATTGATCCAATTGTAACACAATATAGGGCATCTA
                      ____________________________________________________________
consensus GTAAATTTTGCATCCATACTAGTTGTATTGATCCAATTGTAACACAATATAGGGCATCTA
 
. : . : . : . : . : . :
rJMSF017N01+ GCCATTTACCAGAAAGGTCACAGAAGATAGGGAATGAAGGGGATCAATAGAAGGAAGGAT
rJMSF037O13+ GCCATTTACCAGAAAGGTCACAGAAGATAGGGAATGAAGGGGATCAATAGAAGGAAGGAT
rJMFF035L24+ GCCATTTACCAGAAAGGTCACAGAAGATAGGGAATGAAGGGGATCAATAGAAGGAAGGAT
rJMFF005P09+ GCCATTTACCAGAAAGGTCACAGAAGATAGGGAATGAAGGGGATCAATAGAAGGAAGGAT
                      ____________________________________________________________
consensus GCCATTTACCAGAAAGGTCACAGAAGATAGGGAATGAAGGGGATCAATAGAAGGAAGGAT
 
. : . : . : . : . : . :
rJMSF017N01+ TATGTACCATTTCTA
rJMSF037O13+ TATGTACCATTTCTAG-TTTCATTCAGCAT
rJMFF035L24+ TATGTACCATTTCTAGTTTTCATTCAGCATCTGTAGACATTCTTTGGCAAGGGTATTTAT
rJMFF005P09+ TATGTACCATTTCTAGTTTTCATTCAGCATCTGTAGACATTC-TTGGCAAGGGTATTTAT
                      ____________________________________________________________
consensus TATGTACCATTTCTAGTTTTCATTCAGCATCTGTAGACATTCTTTGGCAAGGGTATTTAT