Previous Contig 008402:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005N19Sequence225014147674008402 (3)pir|T44259|T442598e-56lipoic acid synthase (EC 2.8.1.-) [imported] - Arabidopsis thaliana>gb:AB007987_
JMFF039L06Sequence558008402 (3)pir|T44259|T442597e-87lipoic acid synthase (EC 2.8.1.-) [imported] - Arabidopsis thaliana>gb:AB007987_787021573pir|T44259|T442597e-86lipoic acid synthase (EC 2.8.1.-) [imported] - Arabidopsis thaliana>gb:AB007987_
JMSF031L15Sequence616019682pir|T44259|T442595e-52lipoic acid synthase (EC 2.8.1.-) [imported] - Arabidopsis thaliana>gb:AB007987_779008402 (3)pir|T44259|T442592e-81lipoic acid synthase (EC 2.8.1.-) [imported] - Arabidopsis thaliana>gb:AB007987_

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF039L06- TCCACCCCCTCCTGACCCGAATGAA
                      ____________________________________________________________
consensus TCCACCCCCTCCTGACCCGAATGAA
 
. : . : . : . : . : . :
JMFF039L06- CCATCCAATGTGGCTGAGGCAATTGCTTCATGGGGTTTGGATTATGTTGTGATCACTAGT
                      ____________________________________________________________
consensus CCATCCAATGTGGCTGAGGCAATTGCTTCATGGGGTTTGGATTATGTTGTGATCACTAGT
 
. : . : . : . : . : . :
JMFF039L06- GTTGACCGTGATGATTTACCCGACCAAGGAAGCGGTCATTTTACAGAGACAGTACAGAAG
rJMSF031L15+ TTTACAGAGACAGTACAGAAG
                      ____________________________________________________________
consensus GTTGACCGTGATGATTTACCCGACCAAGGAAGCGGTCATTTTACAGAGACAGTACAGAAG
 
. : . : . : . : . : . :
JMFF039L06- CTTAAGGCATTGAAACCAAATATGCTCATAG-AAGCACTGGTTCCGGACTTTAGAGGGGA
rJMSF031L15+ CTTAAGGCATTGAAACCAAATATGCTCATAGNAAGCACTGGTTCCGGACTTTAGAGGGGA
                      ____________________________________________________________
consensus CTTAAGGCATTGAAACCAAATATGCTCATAGNAAGCACTGGTTCCGGACTTTAGAGGGGA
 
. : . : . : . : . : . :
JMFF039L06- TCCTAGTTGTGTTGAGAAAGTTGCAAAGTCTGGATTAGATGTTTTTGCTCATAATATTGA
rJMSF031L15+ TCCTAGTTGTGTTGAGAAAGTTGCAAAGTCTGGATTAGATGTTTTTGCTCATAATATTGA
                      ____________________________________________________________
consensus TCCTAGTTGTGTTGAGAAAGTTGCAAAGTCTGGATTAGATGTTTTTGCTCATAATATTGA
 
. : . : . : . : . : . :
JMFF039L06- AACAGTTGAAGAGCTCCAGAGTGTTGTACGAGATCACCGTGCTAACTTTAAGCAGTCCAT
rJMSF031L15+ AACAGTTGAAGAGCTCCAGAGCGTTGTACGAGATCACCGTGCTAACTTTAAGCAGTCCAT
rJMFF005N19+ TTTAAGCAGTCCAT
                      ____________________________________________________________
consensus AACAGTTGAAGAGCTCCAGAGTGTTGTACGAGATCACCGTGCTAACTTTAAGCAGTCCAT
 
. : . : . : . : . : . :
JMFF039L06- GGATGTCTTAATGATGGCAAAGGACTATGCTCCTGCTGGTACGCTCACCAAGACATCAAT
rJMSF031L15+ GGATGTCTTAATGATGGCAAAGGACTATGCTCCTGCTGGTACGCTCACCAAGACATCAAT
rJMFF005N19+ GGATGTCTTAATAATGGCCAAGGAATATGCACCTACCGGTACACTGACCAAGACATCGAT
                      ____________________________________________________________
consensus GGATGTCTTAATGATGGCAAAGGACTATGCTCCTGCTGGTACGCTCACCAAGACATCAAT
 
. : . : . : . : . : . :
JMFF039L06- AATGTTGGGCTGTGGAGAAACACCAGACCAAGTTGTTAAAACAATGGAAAAGGTACGAGC
rJMSF031L15+ AATGTTGGGCTGTGGAGAAACACCAGACCAAGTTGTTAAAACAATGGAAAAGGTACGAGC
rJMFF005N19+ AATGTTGGGATGTGGAGAAACGCCCGATCAAGTGATTAAAACAATGGAAAAGGTGAGGGA
                      ____________________________________________________________
consensus AATGTTGGGCTGTGGAGAAACACCAGACCAAGTTGTTAAAACAATGGAAAAGGTACGAGC
 
. : . : . : . : . : . :
JMFF039L06- AGCAGGTGTTGATGTAATGACGTTTGGTCAGTATATGAGACCCTCAAAGCGCCACATGCC
rJMSF031L15+ AGCAGGTGTTGATGTAATGACGTTTGGTCAGTATATGAGACCCTCAAAGCGCCACATGCC
rJMFF005N19+ AGCGGGTGTTGATGTAATGACATTTGGGCAATACATGAGACCCTCAAAGCGTCACATGCC
                      ____________________________________________________________
consensus AGCAGGTGTTGATGTAATGACGTTTGGTCAGTATATGAGACCCTCAAAGCGCCACATGCC
 
. : . : . : . : . : . :
JMFF039L06- TGTATCAGAGTACATTACTCCTGAGGCTTTTGAGAAGTATCAAGTCCTTGG
rJMSF031L15+ TGTATCAGAGTACATTACTCCTGAGGCTTTTGAGAAGTATCAAGTCCTTGGGATGCAAAT
rJMFF005N19+ TGTGTCGGAATACATAACTCCAGAAGCTTTTGACAAGTATCGAGTTCTTGGAATGGAAAT
                      ____________________________________________________________
consensus TGTATCAGAGTACATTACTCCTGAGGCTTTTGAGAAGTATCAAGTCCTTGGGATGGAAAT
 
. : . : . : . : . : . :
rJMSF031L15+ GGGATTTCGATATGTGGCATCTGGTCCCATGGTCAGATCATCATACAAGGCAGGAGAATT
rJMFF005N19+ GGGATTCCGGTATGTGGCATCTGGACCGATGGTTAGGTCCTCGTACAAGGCAGGCGAGTT
                      ____________________________________________________________
consensus GGGATTTCGGTATGTGGCATCTGGTCCGATGGTTAGGTCCTCGTACAAGGCAGGCGAGTT
 
. : . : . : . : . : . :
rJMSF031L15+ TTACATTAAGTCTATGATTGAATCAGATCGTGCTGCATCTT
rJMFF005N19+ TTACATAAAATCCATGATAGAATCAGACCGCGCTGCATCTTCAGTGTAACATCCGGTTTT
                      ____________________________________________________________
consensus TTACATTAAGTCTATGATTGAATCAGATCGTGCTGCATCTTCAGTGTAACATCCGGTTTT
 
. : . : . : . : . : . :
rJMFF005N19+ TCATACAATAGAATTTACTGCTTCAGTGGTTTGCTTTATGTGCTCCCCTAATTGCTTGGT
                      ____________________________________________________________
consensus TCATACAATAGAATTTACTGCTTCAGTGGTTTGCTTTATGTGCTCCCCTAATTGCTTGGT
 
. : . : . : . : . : . :
rJMFF005N19+ CTACTTTTGGTGCAAGCCCCATTCAATCTTCTTCCCATCTCAAGCAAGAATCCACAGCAG
                      ____________________________________________________________
consensus CTACTTTTGGTGCAAGCCCCATTCAATCTTCTTCCCATCTCAAGCAAGAATCCACAGCAG
 
. : . : . : . : . : . :
rJMFF005N19+ AGTGTGAGGCAATGGGAAAAACATTATTTGTACTTCATGTTACTTGTACATATGATTGTT
                      ____________________________________________________________
consensus AGTGTGAGGCAATGGGAAAAACATTATTTGTACTTCATGTTACTTGTACATATGATTGTT
 
. : . : . : . : . : . :
rJMFF005N19+ GATGTAATTATAATGTTTTGGATATTGCAATTTGATCATTGTTCAATTGTGTGTAAAGAC
                      ____________________________________________________________
consensus GATGTAATTATAATGTTTTGGATATTGCAATTTGATCATTGTTCAATTGTGTGTAAAGAC
 
. : . : . : . : . : . :
rJMFF005N19+ CTTCCATTTCATACCTCGAATGTTCAATATGATTGGGAATAACAAAGCACAGTATGATGC
                      ____________________________________________________________
consensus CTTCCATTTCATACCTCGAATGTTCAATATGATTGGGAATAACAAAGCACAGTATGATGC