Previous Contig 008399:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005M19Sequence455000287 (3)gb:AY084796_15698806e-11Arabidopsis thaliana clone 118233 mRNA, complete sequence.707008399 (3)pir|T48234|T482341e-50hypothetical protein T7H20.180 - Arabidopsis thaliana>gb:ATT7H20_1556428 Arabido
JMFF015E11Sequence591000287 (3)pir|T48234|T482342e-22hypothetical protein T7H20.180 - Arabidopsis thaliana>gb:ATT7H20_1556428 Arabido710008399 (3)pir|T48234|T482341e-50hypothetical protein T7H20.180 - Arabidopsis thaliana>gb:ATT7H20_1556428 Arabido
JMFF035K02Sequence541000287 (3)pir|T48234|T482348e-19hypothetical protein T7H20.180 - Arabidopsis thaliana>gb:ATT7H20_1556428 Arabido713008399 (3)pir|T48234|T482343e-51hypothetical protein T7H20.180 - Arabidopsis thaliana>gb:ATT7H20_1556428 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF035K02+ TCACCGTATGGGGGATTTTGAAATGGCGAAGCAATTGTACACAAGAGTGATTC
rJMFF015E11+ TATGGGGGATTTTGAAATGGCGAAGCAATTGTACACAAGAGTGATTC
rJMFF005M19+ TATGGGGGATTTTGAAATGGCGAAGCAATTGTACACAAGAGTGATTC
                      ____________________________________________________________
consensus TCACCGTATGGGGGATTTTGAAATGGCGAAGCAATTGTACACAAGAGTGATTC
 
. : . : . : . : . : . :
rJMFF035K02+ ATGAGGAATCTTTGGGCAAAAGTTCTAGTTATCTACATCAGTTATCAGCTTGTAATATGA
rJMFF015E11+ ATGAGGAATCTTTGGGCAAAAGTTCTAGTTATCTACATCAGTTATCAGCTTGTAATATGA
rJMFF005M19+ ATGAGGAATCTTTGGGCAAAAGTTCTAGTTATCTACATCAGTTATCAGCTTGTAATATGA
                      ____________________________________________________________
consensus ATGAGGAATCTTTGGGCAAAAGTTCTAGTTATCTACATCAGTTATCAGCTTGTAATATGA
 
. : . : . : . : . : . :
rJMFF035K02+ ATTTCGAGGATGTTATATTAGGAGCTACTTGTGCTTTAGGACAGCTTGAGGCTCATTTGG
rJMFF015E11+ ATTTCGAGGATGTTATATTAGGAGCTACTTGTGCTTTAGGACAGCTTGAGGCTCATTTGG
rJMFF005M19+ ATTTCGAGGATGTTATATTAGGAGCTACTTGTGCTTTAGGACAGCTTGAGGCTCATTTGG
                      ____________________________________________________________
consensus ATTTCGAGGATGTTATATTAGGAGCTACTTGTGCTTTAGGACAGCTTGAGGCTCATTTGG
 
. : . : . : . : . : . :
rJMFF035K02+ GGAACTTTGACAAAGCAGAGAAGATGCTAACTGAAGCACTGGTGAAAGCGGAAGAAACTT
rJMFF015E11+ GGAACTTTGACAAAGCAGAGAAGATGCTAACTGAAGCACTGGTGAAAGCGGAAGAAACTT
rJMFF005M19+ GGAACTTTGACAAAGCAGAGAAGATGCTAACTGAAGCACTGGTGAAAGCGGAAGAAACTT
                      ____________________________________________________________
consensus GGAACTTTGACAAAGCAGAGAAGATGCTAACTGAAGCACTGGTGAAAGCGGAAGAAACTT
 
. : . : . : . : . : . :
rJMFF035K02+ TTGGTGATCGTCATCCCAAAGTTGGTGTTATTTTAACCTGCGTAGTTCATATGTATCGAA
rJMFF015E11+ TTGGTGATCGTCATCCCAAAGTTGGTGTTATTTTAACCTGCGTAGTTCATATGTATCGAA
rJMFF005M19+ TTGGTGATCGTCATCCCAAAGTTGGTGTTATTTTAACCTGCGTAGTTCATATGTATCGAA
                      ____________________________________________________________
consensus TTGGTGATCGTCATCCCAAAGTTGGTGTTATTTTAACCTGCGTAGTTCATATGTATCGAA
 
. : . : . : . : . : . :
rJMFF035K02+ ATAAATCAACAGTTGAGGAATCGAGCTCTCTTTTAATTCAAGAGGGACTTTACAGAAGGG
rJMFF015E11+ ATAAATCAACAGTTGAGGAATCGAGCTCTCTTTTAATTCAAGAGGGACTTTACAGAAGGG
rJMFF005M19+ ATAAATCAACAGTTGAGGAATCGAGCTCTCTTTTAATTCAAGAGGGACTTTACAGAAGGG
                      ____________________________________________________________
consensus ATAAATCAACAGTTGAGGAATCGAGCTCTCTTTTAATTCAAGAGGGACTTTACAGAAGGG
 
. : . : . : . : . : . :
rJMFF035K02+ CAATTGAATTGCTTAAAGCTCCTCCACTGGAGACTGAAGGTGCTGAAGAGAAGGCTTGCA
rJMFF015E11+ CAATTGAATTGCTTAAAGCTCCTCCACTGGAGACTGAAGGTGCTGAAGAGAAGGCTTGCA
rJMFF005M19+ CAATTGAATTGCTTAAAGCTCCTCCACTGGAGACTGAAGGTGCTGAAGAGAAGGCTTGCA
                      ____________________________________________________________
consensus CAATTGAATTGCTTAAAGCTCCTCCACTGGAGACTGAAGGTGCTGAAGAGAAGGCTTGCA
 
. : . : . : . : . : . :
rJMFF035K02+ GAAGAGATATAATTGCCCTTGCGAGAGGTGGTTATGCAGAAACATTGTGTCTGCAACAGA
rJMFF015E11+ GAAGAGATATAATTGCCCTTGCGAGAGGGGGTTATGCAGAAACATTGTGTCTGCAACAGA
rJMFF005M19+ GAAGAGATATAATTGCCCTTGCGAGAGGTGGTTATGCAGAAACATTGTGTCTGCAACAGA
                      ____________________________________________________________
consensus GAAGAGATATAATTGCCCTTGCGAGAGGTGGTTATGCAGAAACATTGTGTCTGCAACAGA
 
. : . : . : . : . : . :
rJMFF035K02+ ATAGAAAAGCCGAAGGGGAGAGAATAAAGCTTTGGGCAGAATCTGCCTGGAAAAATCCCA
rJMFF015E11+ ATAGAAAAGCCGAAGGGGAGAGAATAAAGCTTTGGGCAGAATCTGCCTGGAAAAATCCCA
rJMFF005M19+ ATAGAAAAGCCGAAGGGGAGAGAATAAAGCTTTGGGCAGAATCTGCCTGGAAAAATCCCA
                      ____________________________________________________________
consensus ATAGAAAAGCCGAAGGGGAGAGAATAAAGCTTTGGGCAGAATCTGCCTGGAAAAATCCCA
 
. : . : . : . : . : . :
rJMFF035K02+ GATTATCCTTAGCTGAAGCACTGGAACCACCTTCTGAGTCTTCTTCCAAAGTGGCTGTTA
rJMFF015E11+ GATTATCCTTAGCTGAAGCACTGGAACCACCTTCTGAGTCTTCTTCCAAAGTGGCTGTTA
rJMFF005M19+ GATTATCCTTAGCTGAAGCACTGGAACCACCTTCTGAGTCTTCTTCCAAAGTGGCTGTTA
                      ____________________________________________________________
consensus GATTATCCTTAGCTGAAGCACTGGAACCACCTTCTGAGTCTTCTTCCAAAGTGGCTGTTA
 
. : . : . : . : . : . :
rJMFF035K02+ TAGATACCAGAATATGCAGGGTCATTTAGATCATTTTTTTGTTTGTTTTCTTTTTTCTAT
rJMFF015E11+ TAGATACCAGAATATGCAGGGTCATTTAGATCATTTTTTTGTTTGTTTTCTTTTTTCTAT
rJMFF005M19+ TAGATACCAGAATATGCAGGGTCATTTAGATCATTTTTTTGTTTGTTTTCTTTTTTCTAT
                      ____________________________________________________________
consensus TAGATACCAGAATATGCAGGGTCATTTAGATCATTTTTTTGTTTGTTTTCTTTTTTCTAT
 
. : . : . : . : . : . :
rJMFF035K02+ CGAAAAATAATGGAAATACAGAAAACATGTTCATCAGTATTTATTACAAGTCAGAAAAT
rJMFF015E11+ CGAAAAATAATGGAAATACAGAAAACATGTTCATCAGTATTTATTACAAGTCAGAAAAT
rJMFF005M19+ CGAAAAATAATGGAAATACAGAAAACATGTTCATCAGTATTTATTACAAGTCAGAAAATA
                      ____________________________________________________________
consensus CGAAAAATAATGGAAATACAGAAAACATGTTCATCAGTATTTATTACAAGTCAGAAAATA