Previous Contig 008392:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005K18Sequence463006059 (3)gb:AC149287_17448951e-16Solanum demissum chromosome 5 clone PGEC568D21 map MAP_LOC, complete sequence.707008392 (2)
JMSF022F09Sequence689006059 (3)gb:AC149290_17449302e-31Solanum demissum chromosome 5 clone PGEC093P17 map MAP_LOC, complete sequence.794008392 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022F09+ GGTGATGNAGGAGTATGGAGTT
                      ____________________________________________________________
consensus GGTGATGNAGGAGTATGGAGTT
 
. : . : . : . : . : . :
rJMSF022F09+ GCGGAATCTTGGACTAAAGTGGTGTCTTTCACGCTGTCTGATCATCATAGGGGCTATATC
                      ____________________________________________________________
consensus GCGGAATCTTGGACTAAAGTGGTGTCTTTCACGCTGTCTGATCATCATAGGGGCTATATC
 
. : . : . : . : . : . :
rJMSF022F09+ ACTGTGTTGCATATGTCTGAGAATGGCGAGGAGGTCTTGCTGAAGCTTGGAACCCAGCTT
                      ____________________________________________________________
consensus ACTGTGTTGCATATGTCTGAGAATGGCGAGGAGGTCTTGCTGAAGCTTGGAACCCAGCTT
 
. : . : . : . : . : . :
rJMSF022F09+ GCGGTTTATAATTCGAGGAATGGATCGTTTAAGCATGTCGAGTGTGTTGCCTCTCCCCGC
rJMFF005K18+ CGAGGAATGGATCGTTTAAGCATGTCGAGTGTGTTGCCTCTCCCCGC
                      ____________________________________________________________
consensus GCGGTTTATAATTCGAGGAATGGATCGTTTAAGCATGTCGAGTGTGTTGCCTCTCCCCGC
 
. : . : . : . : . : . :
rJMSF022F09+ ACTATTGAGGTTCAATCAGCTACCTATGATGAGAGCCTGGCGTTGCTGGATATTGGCCAT
rJMFF005K18+ ACTATTGAGGTTCAATCAGCTACCTATGATGAGAGCCTGGCGTTGCTGGATATTGGCCAT
                      ____________________________________________________________
consensus ACTATTGAGGTTCAATCAGCTACCTATGATGAGAGCCTGGCGTTGCTGGATATTGGCCAT
 
. : . : . : . : . : . :
rJMSF022F09+ GACAGCCAAATCTAAGCAAGAAAAGAGAGAACTAATATGAACAAAACCGAGATTGTTAAA
rJMFF005K18+ GACAGCCAAATCTAAGCAAGAAAAGAGAGAACTAATATGAACAAAACCGAGATTGTTAAA
                      ____________________________________________________________
consensus GACAGCCAAATCTAAGCAAGAAAAGAGAGAACTAATATGAACAAAACCGAGATTGTTAAA
 
. : . : . : . : . : . :
rJMSF022F09+ TTGGAGTTATTCTGCTGTTCGTGATAAAGAACTCGTAGTCCCACGCTCCTAGATGCAGAA
rJMFF005K18+ TTGGAGTTATTCTGCTGTTCGTGATAAAGAACTCGTAGTCCCACGCTCCTAGATGCAGAA
                      ____________________________________________________________
consensus TTGGAGTTATTCTGCTGTTCGTGATAAAGAACTCGTAGTCCCACGCTCCTAGATGCAGAA
 
. : . : . : . : . : . :
rJMSF022F09+ AACGAAGGTTCTATCTCAGAATCGCGGTTTTATGGCAGCAAGGAAGTGCAAGAGTAAGGG
rJMFF005K18+ AACGAAGGTTCTATCTCAGAATCGCGGTTTTATGGCAGCAAGGAAGTGCAAGAGTAAGGG
                      ____________________________________________________________
consensus AACGAAGGTTCTATCTCAGAATCGCGGTTTTATGGCAGCAAGGAAGTGCAAGAGTAAGGG
 
. : . : . : . : . : . :
rJMSF022F09+ CTTCACTCGGTTTCTTGAGTGACAGCCCAACCTTACTGCAGAAAAACCAAGATTCTGCTG
rJMFF005K18+ CTTCACTCGGTTTCTTGAGTGACAGCCCAACCTTACTGCAGAAAAACCAAGATTCTGCTG
                      ____________________________________________________________
consensus CTTCACTCGGTTTCTTGAGTGACAGCCCAACCTTACTGCAGAAAAACCAAGATTCTGCTG
 
. : . : . : . : . : . :
rJMSF022F09+ ACCAAGAATCTCAAGTTTGTGGCCTCAAACAGGTCGAAATGTTAAGAATCTAAATCGTCA
rJMFF005K18+ ACCAAGAATCTCAAGTTTGTGGCCTCAAACAGGTCGAAATGTTAAGAATCTAAATCGTCA
                      ____________________________________________________________
consensus ACCAAGAATCTCAAGTTTGTGGCCTCAAACAGGTCGAAATGTTAAGAATCTAAATCGTCA
 
. : . : . : . : . : . :
rJMSF022F09+ TCATGTCTTGGAAGTGATAAAGAATGTGTGTTTGCTGTTACATGTTGGAAATAGTATATG
rJMFF005K18+ TCATGTCTTGGAAGTGATAAAGAATGTGTGTTTGCTGTTACATGTTGGAAATAGTATATG
                      ____________________________________________________________
consensus TCATGTCTTGGAAGTGATAAAGAATGTGTGTTTGCTGTTACATGTTGGAAATAGTATATG
 
. : . : . : . : . : . :
rJMSF022F09+ AAATATGTATGTATGTAGTGTCAACTTCTGTTAGTATTCTGAGCTGTGTATATCAGATAT
rJMFF005K18+ AAATATGTATGTATGTAGTGTCAACTTCTGTTAGTATTCTGAGCTGTGTATATCAGATAT
                      ____________________________________________________________
consensus AAATATGTATGTATGTAGTGTCAACTTCTGTTAGTATTCTGAGCTGTGTATATCAGATAT
 
. : . : . : . : . : . :
rJMSF022F09+ GGAGCTGGATCAAGTTTATGTTATTGTCATTCAGTGTCCAATAATGAGCAATACAATATA
rJMFF005K18+ GGAGCTGGATCAAGTTTATGTTATTGTCATTCAGTGTCCAATAATGAGCAATACAATATA
                      ____________________________________________________________
consensus GGAGCTGGATCAAGTTTATGTTATTGTCATTCAGTGTCCAATAATGAGCAATACAATATA
 
. : . : . : . : . : . :
rJMSF022F09+ GTGATCCAGCATTCACATTAGTGTTCAACAATCAG-AAAACTACGCAAT
rJMFF005K18+ GTGATCCAGCATTCACATTAGTGTTCAACAATCAGTAAAACTACGCAATTGATTATTTTG
                      ____________________________________________________________
consensus GTGATCCAGCATTCACATTAGTGTTCAACAATCAGTAAAACTACGCAATTGATTATTTTG
 
. : . : . : . : . : . :
rJMFF005K18+ TTTTGTATTCACAAGTTCCTTTCAAATACTGTAATCGCACAGTATTAACATATTAGGATT
                      ____________________________________________________________
consensus TTTTGTATTCACAAGTTCCTTTCAAATACTGTAATCGCACAGTATTAACATATTAGGATT