Previous Contig 008391:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005K11Sequence444008391 (2)gb:AP001304_18210553e-04Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFD22.617008391 (2)gb:AP001304_18210553e-07Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFD22.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF005K11- CACCTTCTTTTTTCATG
rJMFF005K11+ CACCTTCTTTTTTCATG
                      ____________________________________________________________
consensus CACCTTCTTTTTTCATG
 
. : . : . : . : . : . :
JMFF005K11- CTTCTTCTTCTTCTTCTTCTATATAACCCAACAAGAAGAAGCAGCTTTGCTTTTCCTAGT
rJMFF005K11+ CTTCTTCTTCTTCTTCTTCTATATAACCCAACAAGAAGAAGCAGCTTTGCTTTTCCTAGT
                      ____________________________________________________________
consensus CTTCTTCTTCTTCTTCTTCTATATAACCCAACAAGAAGAAGCAGCTTTGCTTTTCCTAGT
 
. : . : . : . : . : . :
JMFF005K11- CTTCTAATCTTTTCTAGAACTGGGGATGACTGTACAGTAGTGAATCCACACAACTAAAGC
rJMFF005K11+ CTTCTAATCTTTTCTAGAACTGGGGATGACTGTACAGTAGTGAATCCACACAACTAAAGC
                      ____________________________________________________________
consensus CTTCTAATCTTTTCTAGAACTGGGGATGACTGTACAGTAGTGAATCCACACAACTAAAGC
 
. : . : . : . : . : . :
JMFF005K11- TTTCTGTTTTCTGTCTCTTTCCTCCCCCTCCAAAATGGGTCCTTCTTGTAGACGACGAAG
rJMFF005K11+ TTTCTGTTTTCTGTCTCTTTCCTCCCCCTCCAAAATGGGTCCTTCTTGTAGACGACGAAG
                      ____________________________________________________________
consensus TTTCTGTTTTCTGTCTCTTTCCTCCCCCTCCAAAATGGGTCCTTCTTGTAGACGACGAAG
 
. : . : . : . : . : . :
JMFF005K11- AAAGCCCAAAGCAGGGTCAAGAAAATCCACGGCGTTTAAATCTTCGCCGCCGTCCAAGGC
rJMFF005K11+ AAAGCCCAAAGCAGGGTCAAGAAAATCCACGGCGTTTAAATCTTCGCCGCCGTCCAAGGC
                      ____________________________________________________________
consensus AAAGCCCAAAGCAGGGTCAAGAAAATCCACGGCGTTTAAATCTTCGCCGCCGTCCAAGGC
 
. : . : . : . : . : . :
JMFF005K11- GGCGGCCTCTCAGGATTCGGTGAAGAAGAACGGCGGCGGCGATCATGAAGGGGACATAGG
rJMFF005K11+ GGCGGCCTCTCAGGATTCGGTGAAGAAGAACGGCGGCGGCGATCATGAAGGGGACATAGG
                      ____________________________________________________________
consensus GGCGGCCTCTCAGGATTCGGTGAAGAAGAACGGCGGCGGCGATCATGAAGGGGACATAGG
 
. : . : . : . : . : . :
JMFF005K11- AGCGGCGGATGACGTGTGCTCGACGCCGAAAGCGGAGAGGTTTCGGATTCCGGCGATGGA
rJMFF005K11+ AGCGGCGGATGACGTGTGCTCGACGCCGAAAGCGGAGAGGTTTCGGATTCCGGCGATGGA
                      ____________________________________________________________
consensus AGCGGCGGATGACGTGTGCTCGACGCCGAAAGCGGAGAGGTTTCGGATTCCGGCGATGGA
 
. : . : . : . : . : . :
JMFF005K11- GACGTGCCCTCCGGCGCCGAAGAAGAGGAGGGTGATGACGACGAATTGGTCGTCGCCGTC
rJMFF005K11+ GACGTGCCCTCCGGCGCCGAAGAAGAGGAGGGTGATGACGACGAATTGGTCGTCGCCGTC
                      ____________________________________________________________
consensus GACGTGCCCTCCGGCGCCGAAGAAGAGGAGGGTGATGACGACGAATTGGTCGTCGCCGTC
 
. : . : . : . : . : . :
JMFF005K11- GTTGCGG
rJMFF005K11+ GTTGCGGAGGAGTAGTAGTAGTAGTACTCCGCCCCCCATCGCGTTCTTTGCTCCGCCGGA
                      ____________________________________________________________
consensus GTTGCGGAGGAGTAGTAGTAGTAGTACTCCGCCCCCCATCGCGTTCTTTGCTCCGCCGGA
 
. : . : . : . : . : . :
rJMFF005K11+ TATTGAGCTCTTCTTTTACTTTGCGCTTCGCGGCGGCGTTTCAGTTTGAATTCAATGCTA
                      ____________________________________________________________
consensus TATTGAGCTCTTCTTTTACTTTGCGCTTCGCGGCGGCGTTTCAGTTTGAATTCAATGCTA
 
. : . : . : . : . : . :
rJMFF005K11+ AGTACTACTCCAAAGAAAGAAAAGCAGTACTCATGTTAATTAGCTTTAATGGAATAACAA
                      ____________________________________________________________
consensus AGTACTACTCCAAAGAAAGAAAAGCAGTACTCATGTTAATTAGCTTTAATGGAATAACAA