Previous Contig 008384:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005H21Sequence465008384 (4)gb:AY116962_15791222e-56Arabidopsis thaliana At1g11930/F12F1_20 mRNA, complete cds.>gb:AF428291_1799221 750008384 (4)pir|B86254|B862546e-77hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890208 Arabid
JMSF035D09Sequence649008384 (4)gb:AY116962_15791224e-86Arabidopsis thaliana At1g11930/F12F1_20 mRNA, complete cds.>gb:AF428291_1799221 747008384 (4)pir|B86254|B862544e-81hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890208 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF005H21- AGAAAGAAG
JMSF035D09- GAAGAAAGAAG
                      ____________________________________________________________
consensus GAAGAAAGAAG
 
. : . : . : . : . : . :
JMFF005H21- AGAAGGAAGATTCCCCACAGCCGTCAGCATCAGGAAATGGCCTCTTCCGCCGCCATAGAC
JMSF035D09- AGAAGGAAGATTCCCCACAGCCGTCAGCATCAGGAAATGGCCTCTTCCGCCGCCATAGAC
                      ____________________________________________________________
consensus AGAAGGAAGATTCCCCACAGCCGTCAGCATCAGGAAATGGCCTCTTCCGCCGCCATAGAC
 
. : . : . : . : . : . :
JMFF005H21- GGCGTGGCATCTACGGCGCTGCGATCGGTTCTGCAGCGGGTGCAGCAGGCCGGCGAACGC
JMSF035D09- GGCGTGGCATCTACGGCGCTGCGATCGGTTCTGCAGCGGGTGCAGCAGGCCGGCGAACGC
                      ____________________________________________________________
consensus GGCGTGGCATCTACGGCGCTGCGATCGGTTCTGCAGCGGGTGCAGCAGGCCGGCGAACGC
 
. : . : . : . : . : . :
JMFF005H21- TGCGGCTGCCAGTCCGACCGGATTCGGGTGGTCGCCGTGAGCAAGACCAAGCCAGCCTCC
JMSF035D09- TGCGGCCGCCAGTCCGACCGGATTCGGGTGGTCGCCGTGAGCAAGACCAAGCCAGCCTCC
                      ____________________________________________________________
consensus TGCGGCTGCCAGTCCGACCGGATTCGGGTGGTCGCCGTGAGCAAGACCAAGCCAGCCTCC
 
. : . : . : . : . : . :
JMFF005H21- CTTATCCGCCAAGTTTACGACTCTGGCCACCGCTGTTTCGGCGAAAATTATGTCCAAGAG
JMSF035D09- CTTATCCGCCAAGTTTACGACTCTGGCCACCGCTGTTTCGGCGAAAATTATGTCCAAGAG
                      ____________________________________________________________
consensus CTTATCCGCCAAGTTTACGACTCTGGCCACCGCTGTTTCGGCGAAAATTATGTCCAAGAG
 
. : . : . : . : . : . :
JMFF005H21- CTCGTCGACAAAGCTCCACAGCTTCCGGAGGATATAGAGTGGCATTTCATCGGCAATTTG
JMSF035D09- CTCGTCGACAAAGCTCCACAGCTTCCGGAGGATATAGAGTGGCATTTCATCGGCAATTTG
rJMSF035D09+ GCTCCACAGCTTCCGGAGGATATAGAGTGGCATTTCATCGGCAATTTG
rJMFF005H21+ GATATAGAGTGGCATTTCATCGGCAATTTG
                      ____________________________________________________________
consensus CTCGTCGACAAAGCTCCACAGCTTCCGGAGGATATAGAGTGGCATTTCATCGGCAATTTG
 
. : . : . : . : . : . :
JMFF005H21- CAGAGCAATAAAGTAAAGCCGCTTCTGACTGGTGTGCCAAATCTTGCAATGGTGGAGACT
JMSF035D09- CAGAGCAATAAAGTAAAGCCGCTTCTGACTGGTGTGCCAAATCTTGCAATGGTGGAGACT
rJMSF035D09+ CAGAGCAATAAAGTAAAGCCGCTTCTGACTGGTGTGCCAAATCTTGCAATGGTGGAGACT
rJMFF005H21+ CAGAGCAATAAAGTAAAGCCGCTTCTGACTGGTGTGCCAAATCTTGCAATGGTGGAGACT
                      ____________________________________________________________
consensus CAGAGCAATAAAGTAAAGCCGCTTCTGACTGGTGTGCCAAATCTTGCAATGGTGGAGACT
 
. : . : . : . : . : . :
JMFF005H21- GTTGATGATGAGAAGATTGCAAATCAGCTTATTCGAGTGGTTGGAAACATTGGAAGGAAA
JMSF035D09- GTTGATGATGAGAAGATTGCAAATCAGCTTAATCGAGTGGTTGGAAACATTGGAAGGAAA
rJMSF035D09+ GTTGATGATGAGAAGATTGCAAATCAGCTTAATCGAGTGGTTGGAAACATTGGAAGGAAA
rJMFF005H21+ GTTGATGATGAGAAGATTGCAAATCAGCTTATTCGAGTGGTTGGAAACATTGGAAGGAAA
                      ____________________________________________________________
consensus GTTGATGATGAGAAGATTGCAAATCAGCTTATTCGAGTGGTTGGAAACATTGGAAGGAAA
 
. : . : . : . : . : . :
JMFF005H21- CCATTGAAGGTTTTCGTTCAAGTGAATACAAGTGG
JMSF035D09- CCATTGAAGGTTTTCGTTCAAGTGAATACAAGTGGAGAAGAAACTAAATCCGGTGTTGAG
rJMSF035D09+ CCATTGAAGGTTTTCGTTCAAGTGAATACAAGTGGAGAAGAAACTAAATCCGGTGTTGAG
rJMFF005H21+ CCATTGAAGGTTTTCGTTCAAGTGAATACAAGTGGAGAAGAAACTAAATCCGGTGTTGAG
                      ____________________________________________________________
consensus CCATTGAAGGTTTTCGTTCAAGTGAATACAAGTGGAGAAGAAACTAAATCCGGTGTTGAG
 
. : . : . : . : . : . :
JMSF035D09- CCAGCTGCGTGTGTGGACCTTGTCAAACACATTAGTTCAAGCTGCCCGAATCTTGAATTC
rJMSF035D09+ CCAGCTGCGTGTGTGGACCTTGTCAAACACATTAGTTCAAGCTGCCCGAATCTTGAATTC
rJMFF005H21+ CCAGCTGCGTGTGTGGACCTTGTCAAACACATTAGTTCAAGCTGCCCGAATCTTGAATTC
                      ____________________________________________________________
consensus CCAGCTGCGTGTGTGGACCTTGTCAAACACATTAGTTCAAGCTGCCCGAATCTTGAATTC
 
. : . : . : . : . : . :
JMSF035D09- AGTGGCCTGATGACAATAGGAATGCCTGACTATACTTCGACCCCTGAGAATTTTAAGACA
rJMSF035D09+ AGTGGCCTGATGACAATAGGAATGCCTGACTATACTTCGACCCCTGAGAATTTTAAGACA
rJMFF005H21+ AGTGGCCTGATGACAATAGGAATGCCTGACTATACTTCGACCCCTGAGAATTTTAAGACA
                      ____________________________________________________________
consensus AGTGGCCTGATGACAATAGGAATGCCTGACTATACTTCGACCCCTGAGAATTTTAAGACA
 
. : . : . : . : . : . :
JMSF035D09- TTAGCAAACTGTAGAAGTGAGGTATGCAAGGCACTTGG
rJMSF035D09+ TTAGCAAACTGTAGAAGTGAGGTATGCAAGGCACTTGGAATAGCTGAAGAGCAGTGTGAG
rJMFF005H21+ TTAGCAAACTGTAGAAGTGAGGTATGCAAGGCACTTGGAATAGCTGAAGAGCAGTGTGAG
                      ____________________________________________________________
consensus TTAGCAAACTGTAGAAGTGAGGTATGCAAGGCACTTGGAATAGCTGAAGAGCAGTGTGAG
 
. : . : . : . : . : . :
rJMSF035D09+ CTGTCAATGGGCATGTCCGGTGACTTTGAACTTGCAATTGAAATGGGCAGTACAAATGTC
rJMFF005H21+ CTGTCAATGGGCATGTCCGGTGACTTTGAACTTGCAATTGAAATGGGCAGTACAAATGTC
                      ____________________________________________________________
consensus CTGTCAATGGGCATGTCCGGTGACTTTGAACTTGCAATTGAAATGGGCAGTACAAATGTC
 
. : . : . : . : . : . :
rJMSF035D09+ AGAGTTGGATCTACAATATTTGGAGCTAGGGAGTATCCAAAGAAGCAATGAAACTAGCTA
rJMFF005H21+ AGAGTTGGATCTACAATATTTGGAGCTAGGGAGTATCCAAAGAAGCAATGAAACTAGCTA
                      ____________________________________________________________
consensus AGAGTTGGATCTACAATATTTGGAGCTAGGGAGTATCCAAAGAAGCAATGAAACTAGCTA
 
. : . : . : . : . : . :
rJMSF035D09+ CTACCAGACACTCGATGACTCGAAGAACCAAATTCATCGCCAATAATGAAAATTCACTAT
rJMFF005H21+ CTACCAGACACTCGATGACTCGAAGAACCAAATTCATCGCCAATAATGAAAATTCACTAT
                      ____________________________________________________________
consensus CTACCAGACACTCGATGACTCGAAGAACCAAATTCATCGCCAATAATGAAAATTCACTAT
 
. : . : . : . : . : . :
rJMSF035D09+ TCGACAGAGCTTTCTTGACAGGAGGATTCATAGATAATGAAAATTTCCTTAGCTTCTTTG
rJMFF005H21+ TCGACAGAGCTTTCTTGACAGGAGGATTCATAGATAATGAAAATTTCCTTAGCTTCTTTG
                      ____________________________________________________________
consensus TCGACAGAGCTTTCTTGACAGGAGGATTCATAGATAATGAAAATTTCCTTAGCTTCTTTG
 
. : . : . : . : . : . :
rJMSF035D09+ CTGCACCTAAGAACTGATTGAGACCTCCATTTATGTAATGGTTTACCTTCACCTATAGCT
rJMFF005H21+ CTGCACCTAAGAACTGATTGAGGCCTCCATTTATGTAATGGTTTACCTTCACCTATAGCT
                      ____________________________________________________________
consensus CTGCACCTAAGAACTGATTGAGGCCTCCATTTATGTAATGGTTTACCTTCACCTATAGCT
 
. : . : . : . : . : . :
rJMSF035D09+ CTCTGGCCAAGCCCGAGTCTATAACTATAGCTGGAATGA
rJMFF005H21+ CTCTGGCCAAGCCCGAGTCTATAACTATAGCTGGAATGATGATATTAACTTTTTAATCAT
                      ____________________________________________________________
consensus CTCTGGCCAAGCCCGAGTCTATAACTATAGCTGGAATGATGATATTAACTTTTTAATCAT