Previous Contig 008373:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005E09Sequence509008048 (2)gb:AY093731_15753917e-40Arabidopsis thaliana AT5g62130/mtg10_150 mRNA, complete cds.>gb:AF410293_1797107716008373 (2)gb:AC135422_17422912e-59Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0043H23, complet
JMSF051F23Sequence656008048 (2)gb:AY093731_15753919e-52Arabidopsis thaliana AT5g62130/mtg10_150 mRNA, complete cds.>gb:AF410293_1797107757008373 (2)gb:AC135422_17422914e-68Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0043H23, complet

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051F23+ TATGAGTACACTGGCCTGTGGCACATCTATGCTATTTTATCAATGAACTCTTGGT
                      ____________________________________________________________
consensus TATGAGTACACTGGCCTGTGGCACATCTATGCTATTTTATCAATGAACTCTTGGT
 
. : . : . : . : . : . :
rJMSF051F23+ TTTGGAGTGCTGTTTTTCATAGCAGAGATGTGGATTTGACTGAGAGACTAGACCATTCTT
rJMFF005E09+ GAGTGCTGTTTTTCATAGCAGAGATGTGGATTTGACTGAGAGACTAGACCATTCTT
                      ____________________________________________________________
consensus TTTGGAGTGCTGTTTTTCATAGCAGAGATGTGGATTTGACTGAGAGACTAGACCATTCTT
 
. : . : . : . : . : . :
rJMSF051F23+ CTGCCGTGGC--TACTTGGGTTTTCTGTTATCTTGGCTATATTGCGAACTTTCAATGTGC
rJMFF005E09+ CTGCCGTGGCTTTACTTGGGTTTTCTGTTATCTTGGCTATATTGCGAACTTTCAATGTGC
                      ____________________________________________________________
consensus CTGCCGTGGCTTTACTTGGGTTTTCTGTTATCTTGGCTATATTGCGAACTTTCAATGTGC
 
. : . : . : . : . : . :
rJMSF051F23+ GAGATGAGGCGCCCAGAGTAATGGTTGCTTCTCCAATTATTGCATTTGTGACAACCCATA
rJMFF005E09+ GAGATGAGGCGCCCAGAGTAATGGTTGCTTCTCCAATTATTGCATTTGTGACAACCCATA
                      ____________________________________________________________
consensus GAGATGAGGCGCCCAGAGTAATGGTTGCTTCTCCAATTATTGCATTTGTGACAACCCATA
 
. : . : . : . : . : . :
rJMSF051F23+ TCTTGTATCTTAACTTCTATCAATTTGATTATGGTTTGAACCGGAAGGTGTGTTTTGGTA
rJMFF005E09+ TCTTGTATCTTAACTTCTATCAATTTGATTATGGTTTGAACCGGAAGGTGTGTTTTGGTA
                      ____________________________________________________________
consensus TCTTGTATCTTAACTTCTATCAATTTGATTATGGTTTGAACCGGAAGGTGTGTTTTGGTA
 
. : . : . : . : . : . :
rJMSF051F23+ TGGTGATGGCGAAGCTTACAATATGGGGTGTATGGGCAGGGGTTAGTCGTCATCCATCAC
rJMFF005E09+ TGGTGATGGCGAAGCTTACAATATGGGGTGTATGGGCAGGGGTTAGTCGTCATCCATCAC
                      ____________________________________________________________
consensus TGGTGATGGCGAAGCTTACAATATGGGGTGTATGGGCAGGGGTTAGTCGTCATCCATCAC
 
. : . : . : . : . : . :
rJMSF051F23+ GGTGGAAGCTGTGGGTGGTGGTGATTGGGGGAGTTGTTGCCACCGTTGTTGAAGTATTCG
rJMFF005E09+ GGTGGAAGCTGTGGGTGGTGGTGATTGGGGGAGTTGTTGCCACCGTTGTTGAAGTATTCG
                      ____________________________________________________________
consensus GGTGGAAGCTGTGGGTGGTGGTGATTGGGGGAGTTGTTGCCACCGTTGTTGAAGTATTCG
 
. : . : . : . : . : . :
rJMSF051F23+ ACTTTGCTCCATACTGGGGATACGTGGATGCCCATGCTGTTTGGCATGCCACCTGCATTC
rJMFF005E09+ ACTTTGCTCCATACTGGGGATACGTGGATGCCCATGCTGTTTGGCATGCCACCTGCATTC
                      ____________________________________________________________
consensus ACTTTGCTCCATACTGGGGATACGTGGATGCCCATGCTGTTTGGCATGCCACCTGCATTC
 
. : . : . : . : . : . :
rJMSF051F23+ CTCTCACCTACTTGTTTTGGAGTTTTGTAAGGGATGACAGTGAATTCAGGACAACTAGTC
rJMFF005E09+ CTCTCACCTACTTGTTTTGGAGTTTTGTAAGGGATGACAGTGAATTCAGGACAACTAGTC
                      ____________________________________________________________
consensus CTCTCACCTACTTGTTTTGGAGTTTTGTAAGGGATGACAGTGAATTCAGGACAACTAGTC
 
. : . : . : . : . : . :
rJMSF051F23+ TGAGTAAGAAGGCAAAGTAGGATGGATCTGCCAAACTGTTGTGATGATGATCGTATCAAA
rJMFF005E09+ TGAGTAAGAAGGCAAAGTAGGATGGATCTGCCAAACTGTTGTGATGATGATCGTATCAAA
                      ____________________________________________________________
consensus TGAGTAAGAAGGCAAAGTAGGATGGATCTGCCAAACTGTTGTGATGATGATCGTATCAAA
 
. : . : . : . : . : . :
rJMSF051F23+ CTGGATCACCTTTGTATTGGGTCTTTGTTACAGTATCAGCAGACTGTCTTCCTCATTTTT
rJMFF005E09+ CTGGATCACCTTTGTATTGGGTCTTTGTTACAGTATCAGCAGACTGTCTTCCTCATTTTT
                      ____________________________________________________________
consensus CTGGATCACCTTTGTATTGGGTCTTTGTTACAGTATCAGCAGACTGTCTTCCTCATTTTT
 
. : . : . : . : . : . :
rJMSF051F23+ TCTTTTGGGGTTGTTTTTTCTCGCATGATTTGCCTGGGTGCTCACTCCATGCGGGTTTCT
rJMFF005E09+ TCTTTTGGGGTTGTTTTTTCTCGCATGATTTGCCTGGGTGCTCACTCCATGCGGGTTTCT
                      ____________________________________________________________
consensus TCTTTTGGGGTTGTTTTTTCTCGCATGATTTGCCTGGGTGCTCACTCCATGCGGGTTTCT
 
. : . : . : . : . : . :
rJMSF051F23+ TTGTTCTATGTTTTAATTCCATAGGTGTAGGGCTATTAGATGCA
rJMFF005E09+ TTGTTCTATGTTTTAATTCCATAGGTGTAGGGCTATTAGATGCATTGTTTGTGTTGCAAA
                      ____________________________________________________________
consensus TTGTTCTATGTTTTAATTCCATAGGTGTAGGGCTATTAGATGCATTGTTTGTGTTGCAAA