Previous Contig 008368:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005D09Sequence476001044 (3)gb:ATAC013454_15435262e-49Arabidopsis thaliana chromosome III BAC F2O10 genomic sequence, complete sequenc632008368 (3)gb:BT015374_16422027e-66Arabidopsis thaliana At5g26670 mRNA, complete cds.
JMFF006H13Sequence542001044 (3)gb:ATAC013454_15435262e-58Arabidopsis thaliana chromosome III BAC F2O10 genomic sequence, complete sequenc609008368 (3)gb:BT015374_16422027e-66Arabidopsis thaliana At5g26670 mRNA, complete cds.
JMFF020N13Sequence414001044 (3)gb:AY123981_15800645e-16Arabidopsis thaliana At1g57590/T8L23_6 mRNA, complete cds.627008368 (3)gb:BT015374_16422027e-66Arabidopsis thaliana At5g26670 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF020N13+ CTCGTGCTTCTTTCCTCAGAATTTGATCGCA
rJMFF006H13+ CTCGTGCTTCTTTCCTCAGAATTTGATCGCA
rJMFF005D09+ CCTCGTGCTTCTTTCCTCAGAATTTGATCGCA
                      ____________________________________________________________
consensus CCTCGTGCTTCTTTCCTCAGAATTTGATCGCA
 
. : . : . : . : . : . :
rJMFF020N13+ AACATCAACACTCCGCTCTTCTTACTCAATGCTGCCTATGATTCGTGGCAGGTCCAAGCC
rJMFF006H13+ AACATCAACACTCCGCTCTTCTTACTCAATGCTGCCTATGATTCGTGGCAGGTCCAAGCC
rJMFF005D09+ AACATCAACACTCCGCTCTTCTTACTCAATGCTGCCTATGATTCGTGGCAGGTCCAAGCC
                      ____________________________________________________________
consensus AACATCAACACTCCGCTCTTCTTACTCAATGCTGCCTATGATTCGTGGCAGGTCCAAGCC
 
. : . : . : . : . : . :
rJMFF020N13+ AGCTTGGCTCCTCCTTCAGCTGACCCGAATGGGGCTTGGCATGACTGCAAAGCGGACCAT
rJMFF006H13+ AGCTTGGCTCCTCCTTCAGCTGACCCGAATGGGGCTTGGCATGACTGCAAAGCGGACCAT
rJMFF005D09+ AGCTTGGCTCCTCCTTCAGCTGACCCGAATGGGGCTTGGCATGACTGCAAAGCGGACCAT
                      ____________________________________________________________
consensus AGCTTGGCTCCTCCTTCAGCTGACCCGAATGGGGCTTGGCATGACTGCAAAGCGGACCAT
 
. : . : . : . : . : . :
rJMFF020N13+ CAGAAATGCTCGACGTCACAGATTAAATTTCTGCAAGGATTTAGGAATGATATGCTGGAC
rJMFF006H13+ CAGAAATGCTCGACGTCACAGATTAAATTTCTGCAAGGATTTAGGAATGATATGCTGGAC
rJMFF005D09+ CAGAAATGCTCGACGTCACAGATTAAATTTCTGCAAGGATTTAGGAATGATATGCTGGAC
                      ____________________________________________________________
consensus CAGAAATGCTCGACGTCACAGATTAAATTTCTGCAAGGATTTAGGAATGATATGCTGGAC
 
. : . : . : . : . : . :
rJMFF020N13+ GCTGTAAAGGGGTTCGCAGCTTCTAAACAGACGGGCTTGTTCATAAATTCATGCTTCGCC
rJMFF006H13+ GCTGTAAAGGGGTTCGCAGCTTCTAAACAGACGGGCTTGTTCATAAATTCATGCTTCGCC
rJMFF005D09+ GCTGTAAAGGGGTTCGCAGCTTCTAAACAGACGGGCTTGTTCATAAATTCATGCTTCGCC
                      ____________________________________________________________
consensus GCTGTAAAGGGGTTCGCAGCTTCTAAACAGACGGGCTTGTTCATAAATTCATGCTTCGCC
 
. : . : . : . : . : . :
rJMFF020N13+ CACTGCCAGTCCGAGAGGCAGGATACATGGTTCGCTGACGATTCTCCTGTTATCAATAAC
rJMFF006H13+ CACTGCCAGTCCGAGAGGCAGGATACATGGTTCGCTGACGATTCTCCTGTTATCAATAAC
rJMFF005D09+ CACTGCCAGTCCGAGAGGCAGGATACATGGTTCGCTGACGATTCTCCTGTTATCAATAAC
                      ____________________________________________________________
consensus CACTGCCAGTCCGAGAGGCAGGATACATGGTTCGCTGACGATTCTCCTGTTATCAATAAC
 
. : . : . : . : . : . :
rJMFF020N13+ AAGGCAATTGCACTTGCGGTTGGAGATTGGTATTTTGATCGGGCTAGCGTGAAATATATT
rJMFF006H13+ AAGGCAATTGCACTTGCGGTTGGAGATTGGTATTTTGATCGGGCTAGCGTGAAATATATT
rJMFF005D09+ AAGGCAATTGCACTTGCGGTTGGAGATTGGTATTTTGATCGGGCTAGCGTGAAATATATT
                      ____________________________________________________________
consensus AAGGCAATTGCACTTGCGGTTGGAGATTGGTATTTTGATCGGGCTAGCGTGAAATATATT
 
. : . : . : . : . : . :
rJMFF020N13+ GACTGCGCATACCCTTGTGACAAAACATGCCACAACTTGGTGTTCAGATGAGCCTGAGCC
rJMFF006H13+ GACTGCGCATACCCTTGTGACAAAACATGCCACAACTTGGTGTTCAGATGAGCCTGAGCC
rJMFF005D09+ GACTGCGCATACCCTTGTGACAAAACATGCCACAACTTGGTGTTCAGATGAGCCTGAGCC
                      ____________________________________________________________
consensus GACTGCGCATACCCTTGTGACAAAACATGCCACAACTTGGTGTTCAGATGAGCCTGAGCC
 
. : . : . : . : . : . :
rJMFF020N13+ TGAGCCTGCACTTTTTATTTCTTTAATTTATTGAAAGAGTATAATAATTTTAGCTGAGTT
rJMFF006H13+ TGAGCCTGCACTTTTTATTTCTTTAATTTATTGAAAGAGTATAATAATTTTAGCTGAGTT
rJMFF005D09+ TGAGCCTGCACTTTTTATTTCTTTAATTTATTGAAAGAGTATAATAATTTTAGCTGAGTT
                      ____________________________________________________________
consensus TGAGCCTGCACTTTTTATTTCTTTAATTTATTGAAAGAGTATAATAATTTTAGCTGAGTT
 
. : . : . : . : . : . :
rJMFF020N13+ TATATAAGATAATCTGTGTCAGTAATTTATGTTTCCCATTAATTTGCAAATGTAAAAGAA
rJMFF006H13+ TATATAAGATAATCTGTGTCAGTAATTTATGTTTCCCATTAATTTGCAAATGTAAAAGAA
rJMFF005D09+ TATATAAGATAATCTGTGTCAGTAATTTATGTTTCCCATTAATTTGCAAATGTAAAAGAA
                      ____________________________________________________________
consensus TATATAAGATAATCTGTGTCAGTAATTTATGTTTCCCATTAATTTGCAAATGTAAAAGAA
 
. : . : . : . : . : . :
rJMFF020N13+ TTAAGGGATACAATAATGTGATGATTGTCTTGTCTTGTTGTAAGCAATTGTATTAA
rJMFF006H13+ TTAAGGGATACAATAATGTGATGATTGTCTTGTCTTG
rJMFF005D09+ TTAAGGGATACAATAATGTGATGATTGTCTTGTCTTGTTGTAAGCAATTGTATTAATATT
                      ____________________________________________________________
consensus TTAAGGGATACAATAATGTGATGATTGTCTTGTCTTGTTGTAAGCAATTGTATTAATATT