Previous Contig 008366:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005C22Sequence164000246 (5)gb:AY532656_16120630.005Nicotiana tabacum putative pyridoxine biosynthesis protein isoform A (Pdx1-A) ge673008366 (3)sp|Q39963|PDX1_HEVBR4e-47Probable pyridoxin biosynthesis protein ER1 (PDX1 homolog) (Ethylene- inducible
JMFF043H05Sequence644000246 (5)gb:AY532656_16120634e-92Nicotiana tabacum putative pyridoxine biosynthesis protein isoform A (Pdx1-A) ge465008366 (3)gb:AY088650_15736665e-32Arabidopsis thaliana clone 8877 mRNA, complete sequence.
JMFN003K18Sequence512008366 (3)sp|Q8L940|PXL3_ARATH9e-40Probable pyridoxin biosynthesis PDX1-like protein 3.>pir|T48163|T48163 pyridoxin

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF005C22+ GTCTTCACATTCG
                      ____________________________________________________________
consensus GTCTTCACATTCG
 
. : . : . : . : . : . :
JMFN003K18- TCGTCATGCAGACCAAGCAGCTGGGAAGGCTCC
rJMFF005C22+ CCAAGAAGATTCAGGCCCCCTATGACCTCGTCATGCAGACCAAGCAGCTGGGAAGGCTCC
                      ____________________________________________________________
consensus CCAAGAAGATTCAGGCCCCCTATGACCTCGTCATGCAGACCAAGCAGCTGGGAAGGCTCC
 
. : . : . : . : . : . :
JMFN003K18- CCGTCGTCCAATTCGCCGCCGGCGGGGTCGCCACTCCCGCTGACGCCGCCCTAATGATGC
rJMFF043H05+ GCCGCCGGCGGGGTCGCCACTCCCGCTGACGCCGCCCTAATGATGC
rJMFF005C22+ CCGTCGTCCAATTCGCCGCCGGCGGGGTCGCCACTCCCGCTGACGCCGCCCTAATGATGC
                      ____________________________________________________________
consensus CCGTCGTCCAATTCGCCGCCGGCGGGGTCGCCACTCCCGCTGACGCCGCCCTAATGATGC
 
. : . : . : . : . : . :
JMFN003K18- AACTCGGCTGCGACGGCGTGTTCGTCGGCTCCGGGATCTTCAAGAGCGGCGACCCTGCCA
rJMFF043H05+ AACTCGGCTGCGACGGCGTGTTCGTCGGCTCCGGGATCTTCAAGAGCGGCGACCCTGCCA
rJMFF005C22+ AACTCGGCTGCGACGGCGTGTTCGTCGGCTCCGGGATCTTCAAGAGCGGCGACCCTGCCA
                      ____________________________________________________________
consensus AACTCGGCTGCGACGGCGTGTTCGTCGGCTCCGGGATCTTCAAGAGCGGCGACCCTGCCA
 
. : . : . : . : . : . :
JMFN003K18- GGAGGGCCCGTGCAATCGTCCAGGCCGTCACTCACTACAGCGACCCAGAAGTTCTGGCTG
rJMFF043H05+ GGAGGGCCCGCGCAATCGTCCAGGCCGTCACTCACTACAGCGACCCAGAAGTTCTGGCTG
rJMFF005C22+ GGAGGGCCCGCGCAATCGTCCAGGCCGTCACTCACTACAGCGACCCAGAAGTTCTGGCTG
                      ____________________________________________________________
consensus GGAGGGCCCGCGCAATCGTCCAGGCCGTCACTCACTACAGCGACCCAGAAGTTCTGGCTG
 
. : . : . : . : . : . :
JMFN003K18- AAGTTAGCTGCGGCCTCGGCGAGGCTATGGTAGGGATCAATCTCAATGATGCTAAGGTTG
rJMFF043H05+ AAGTTAGCTGCGGCCTCGGCGAGGCTATGGTAGGGATCAATCTCAATGATGCTAAGGTTG
rJMFF005C22+ AAGTTAGCTGCGGCCTCGGCGAGGCTATGGTAGGGATCAATCTCAATGATGCTAAGGTTG
                      ____________________________________________________________
consensus AAGTTAGCTGCGGCCTCGGCGAGGCTATGGTAGGGATCAATCTCAATGATGCTAAGGTTG
 
. : . : . : . : . : . :
JMFN003K18- AGAGGTACGCAAACCGTTCCGAATAGGAACGGTCTGCAAATGGCTCGCTCTACAATAATA
rJMFF043H05+ AGAGGTACGCAAACCGTTCCGAATAGGAACGGTCTGCAAATGGCTCGCTCTACAATAATA
rJMFF005C22+ AGAGGTACGCAAACCGTTCCGAATAGGAACGGTCTGCAAATGGCTCGCTCTACAATAATA
                      ____________________________________________________________
consensus AGAGGTACGCAAACCGTTCCGAATAGGAACGGTCTGCAAATGGCTCGCTCTACAATAATA
 
. : . : . : . : . : . :
JMFN003K18- TGAATCAATTTAGTTTCTGAATATTTTGATTGAGGTTTCTTGAAAGGAACCTCTGCTTGT
rJMFF043H05+ TGAATCAATTTAGTTTCTGAATATTTTGATTGAGGTTTCTTGAAAGGAACCTCTGCTTGT
rJMFF005C22+ TGAATCAATTTAGTTTCTGAATATTTTGATTGAGGTTTCTTGAAAGGAACCTCTGCTTGT
                      ____________________________________________________________
consensus TGAATCAATTTAGTTTCTGAATATTTTGATTGAGGTTTCTTGAAAGGAACCTCTGCTTGT
 
. : . : . : . : . : . :
JMFN003K18- GCTTGGCTTAGTAGATGTCACTCAGTTTATTGTCAAATCTGTTGGTCTATATACATTTTA
rJMFF043H05+ GCTTGGCTTAGTAGATGTCACTCAGTTTATTGTCAAATCTGTTGGTCTATATACATTTTA
rJMFF005C22+ GCTTGGCTTAGTAGATGTCACTCAGTTTATTGTCAAATCTGTTGGTCTATATACATTTTA
                      ____________________________________________________________
consensus GCTTGGCTTAGTAGATGTCACTCAGTTTATTGTCAAATCTGTTGGTCTATATACATTTTA
 
. : . : . : . : . : . :
JMFN003K18- GTACTGGGAATATGTTGTAATGGTGACTTTTGGTTTCCATTAAATGATGTTCTTTGTCT
rJMFF043H05+ GTACTGGGAATATGTTGTAATGGTGACTTTTGGTTTCCATTAAATGATGTTCTTTGTCT
rJMFF005C22+ GTACTGGGAATATGTTGTAATGGTGACTTTTGGTTTCCATTAAATGATGTTCTTTGTCTA
                      ____________________________________________________________
consensus GTACTGGGAATATGTTGTAATGGTGACTTTTGGTTTCCATTAAATGATGTTCTTTGTCTA
 
. : . : . : . : . : . :
rJMFF005C22+ TATTGGTGTTCCCTCTTGTCATCTTGTTATTGCATTATTGTTTATAGTACTTTAACAAGT
                      ____________________________________________________________
consensus TATTGGTGTTCCCTCTTGTCATCTTGTTATTGCATTATTGTTTATAGTACTTTAACAAGT
 
. : . : . : . : . : . :
rJMFF005C22+ CAAGGTAGAACATTTGCAGATAATTCAAAAACATATATAATTGTATAAAAATTCCTTAAA
                      ____________________________________________________________
consensus CAAGGTAGAACATTTGCAGATAATTCAAAAACATATATAATTGTATAAAAATTCCTTAAA