Previous Contig 008361:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005B13Sequence405000241 (2)gb:CRO251269_16734718e-25Catharanthus roseus mRNA for geraniol 10-hydroxylase (g10h gene).641008361 (2)gb:AX028842_14571821e-72Sequence 26 from Patent WO9732023.
JMFF030E14Sequence488000241 (2)gb:CRO251269_16734711e-39Catharanthus roseus mRNA for geraniol 10-hydroxylase (g10h gene).762008361 (2)gb:AX028842_14571829e-86Sequence 26 from Patent WO9732023.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF030E14+ GAGGAGAGGAGAGTCAGCGGCAACAAAAACGTTTGATGTATTAGAT
                      ____________________________________________________________
consensus GAGGAGAGGAGAGTCAGCGGCAACAAAAACGTTTGATGTATTAGAT
 
. : . : . : . : . : . :
rJMFF030E14+ ACACTTCTCAACATCAGCCAAGAAACACCAGATGAGATTGATAATACCATAATTAAGCAT
                      ____________________________________________________________
consensus ACACTTCTCAACATCAGCCAAGAAACACCAGATGAGATTGATAATACCATAATTAAGCAT
 
. : . : . : . : . : . :
rJMFF030E14+ CTTTGCTTGGACTTGTTTGCTGCGGGGACCGATACATCTTCGAACACAGTAGAGTGGGCA
rJMFF005B13+ CTGCGGGGACCGATACATCTTCGAACACAGTAGAGTGGGCA
                      ____________________________________________________________
consensus CTTTGCTTGGACTTGTTTGCTGCGGGGACCGATACATCTTCGAACACAGTAGAGTGGGCA
 
. : . : . : . : . : . :
rJMFF030E14+ ATGACAGAACTTCTTAATAACCCTGAGGCTATGGCAAAAGCTCAAGCAGAGCTTGCAGAT
rJMFF005B13+ ATGACAGAACTTCTTAATAACCCTGAGGCTATGGCAAAAGCTCAAGCAGAGCTTGCAGAT
                      ____________________________________________________________
consensus ATGACAGAACTTCTTAATAACCCTGAGGCTATGGCAAAAGCTCAAGCAGAGCTTGCAGAT
 
. : . : . : . : . : . :
rJMFF030E14+ GTTATTGGCAAAGGGAAGCTATTAGACGAAGCTGATGTTACTGGCCTTTCTTACTTGCAA
rJMFF005B13+ GTTATTGGCAAAGGGAAGCTATTAGACGAAGCTGATGTTACTGGCCTTTCTTACTTGCAA
                      ____________________________________________________________
consensus GTTATTGGCAAAGGGAAGCTATTAGACGAAGCTGATGTTACTGGCCTTTCTTACTTGCAA
 
. : . : . : . : . : . :
rJMFF030E14+ TGCATTGTGAAAGAAACATTCAGACTACACCCACCAGCTCCGCTCTTACTTCCACGTAGA
rJMFF005B13+ TGCATTGTGAAAGAAACATTCAGACTACACCCACCAGCTCCGCTCTTACTTCCACGTAGA
                      ____________________________________________________________
consensus TGCATTGTGAAAGAAACATTCAGACTACACCCACCAGCTCCGCTCTTACTTCCACGTAGA
 
. : . : . : . : . : . :
rJMFF030E14+ GTTGAACAAGATGTGGTCCTATGTGGATATACCATACCTAAGGACTCCAAGATTCTAATC
rJMFF005B13+ GTTGAACAAGATGTGGTCCTATGTGGATATACCATACCTAAGGACTCCAAGATTCTAATC
                      ____________________________________________________________
consensus GTTGAACAAGATGTGGTCCTATGTGGATATACCATACCTAAGGACTCCAAGATTCTAATC
 
. : . : . : . : . : . :
rJMFF030E14+ AATGTATGGGCAATGGGGCGGGATCCAAGTATTTGGAAAAATCCATTGATGTTTAATCCT
rJMFF005B13+ AATGTATGGGCAATGGGGCGGGATCCAAGTATTTGGAAAAATCCATTGATGTTTAATCCT
                      ____________________________________________________________
consensus AATGTATGGGCAATGGGGCGGGATCCAAGTATTTGGAAAAATCCATTGATGTTTAATCCT
 
. : . : . : . : . : . :
rJMFF030E14+ GAAAGGTTTTCGAATTCTGAAATAGATGTCAGAGGGCGTGATTTTGAGCTTATTCCATTT
rJMFF005B13+ GAAAGGTTTTCGAATTCTGAAATAGATGTCAGAGGGCGTGATTTTGAGCTTATTCCATTT
                      ____________________________________________________________
consensus GAAAGGTTTTCGAATTCTGAAATAGATGTCAGAGGGCGTGATTTTGAGCTTATTCCATTT
 
. : . : . : . : . : . :
rJMFF030E14+ GGTGCTGGTCGAAGGATTTGCCCCGCAATGCCAATGGCATTGAGAATGGTTCCAGTAATG
rJMFF005B13+ GGTGCTGGTCGAAGGATTTGCCCCGCAATGCCAATGGCATTGAGAATGGTTCCAGTAATG
                      ____________________________________________________________
consensus GGTGCTGGTCGAAGGATTTGCCCCGCAATGCCAATGGCATTGAGAATGGTTCCAGTAATG
 
. : . : . : . : . : . :
rJMFF030E14+ CTAGGGTCATTGTTGAACTCATTTCGGTGGAAGATTGAAGGTGACATAGCACCAAAGGAT
rJMFF005B13+ CTAGGGTCATTGTTGAACTCATTTCGGTGGAAGATTGAAGGTGACATAGCACCAAAGGAT
                      ____________________________________________________________
consensus CTAGGGTCATTGTTGAACTCATTTCGGTGGAAGATTGAAGGTGACATAGCACCAAAGGAT
 
. : . : . : . : . : . :
rJMFF030E14+ TTGAACATGGAAGAGAAGTTTGGGATTACATTGGCTAAAGCTCATCCTCTTAGAGCCATC
rJMFF005B13+ TTGAACATGGAAGAGAAGTTTGGGATTACATTGGCTAAAGCTCATCCTCTTAGAGCCATC
                      ____________________________________________________________
consensus TTGAACATGGAAGAGAAGTTTGGGATTACATTGGCTAAAGCTCATCCTCTTAGAGCCATC
 
. : . : . : . : . : . :
rJMFF030E14+ CCTATTCCCTTGTAACGTAGTACCACTCTAGTTTTATTCTCAATCCATATATAATA
rJMFF005B13+ CCTATTCCCTTGTAACGTAGTACCACTCTAGTTTTATTCTCAATCCATATATAATAGTTT
                      ____________________________________________________________
consensus CCTATTCCCTTGTAACGTAGTACCACTCTAGTTTTATTCTCAATCCATATATAATAGTTT