Previous Contig 008358:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005A08Sequence407000237 (5)gb:AY142492_15829215e-17Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.685008358 (5)gb:AY142492_15829212e-46Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.
JMFF008M15Sequence573000237 (5)gb:AY142492_15829219e-22Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.719008358 (5)gb:AY142492_15829214e-61Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.
JMFF022N19Sequence471000237 (5)gb:AY142492_15829214e-18Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.701008358 (5)gb:AY142492_15829214e-61Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.
JMFF033C02Sequence576000237 (5)gb:AY142492_15829219e-22Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.780008358 (5)gb:AY142492_15829213e-67Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.
JMFF038N17Sequence541000237 (5)gb:AY142492_15829218e-21Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.788008358 (5)gb:AY142492_15829215e-63Arabidopsis thaliana unknown protein (At3g52610) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF033C02+ CTCGCAGGTTGCAAAT
                      ____________________________________________________________
consensus CTCGCAGGTTGCAAAT
 
. : . : . : . : . : . :
rJMFF033C02+ CTGCTGGGATCAAGTTATGTGGAGTTTTAACAGCAGCAGGATTAATGGCAGCACATTCTT
rJMFF038N17+ TGCTGGGATCAAGTTATGTGGAGTTTTAACAGCAGCAGGATTAATGGCAGCACATTCTT
                      ____________________________________________________________
consensus CTGCTGGGATCAAGTTATGTGGAGTTTTAACAGCAGCAGGATTAATGGCAGCACATTCTT
 
. : . : . : . : . : . :
rJMFF033C02+ CAAGATCCCAGTGGGATCATCATCAGCAGCAGAAGAAGAAATATGGAGTTGTGACACTCA
rJMFF022N19+ GTGGGATCATCATCAGCAGCAGAAGAAGAAATATGGAGTTGTGACACTCA
rJMFF038N17+ CAAGATCCCAGTGGGATCATCATCAGCAGCAGAAGAAGAAATATGGAGTTGTGACACTCA
rJMFF008M15+ GTGGGATCATCATCAGCAGCAGAAGAAGAAATATGGAGTTGTGACACTCA
                      ____________________________________________________________
consensus CAAGATCCCAGTGGGATCATCATCAGCAGCAGAAGAAGAAATATGGAGTTGTGACACTCA
 
. : . : . : . : . : . :
rJMFF033C02+ CTGATTGCCGTTCAATTCTTGATCCCCCTCTTTCTTCTCACCATTATGGATTCTATCACT
rJMFF022N19+ CTGATTGCCGTTCAATTCTTGATCCCCCTCTTTCTTCTCACCATTATGGATTCTATCACT
rJMFF038N17+ CTGATNGCCGTTCAATTCTTGATCCCCCTCTTTCTTCTCACCATTATGGATTCTATCACT
rJMFF008M15+ CTGATTGCCGTTCAATTCTTGATCCCCCTCTTTCTTCTCACCATTATGGATTCTATCACT
rJMFF005A08+ TTCTCACCATTATGGATTCTATCACT
                      ____________________________________________________________
consensus CTGATTGCCGTTCAATTCTTGATCCCCCTCTTTCTTCTCACCATTATGGATTCTATCACT
 
. : . : . : . : . : . :
rJMFF033C02+ CTGCAATTCTGAACATGCACACCGTGAAGGGTGGAGAAAGGCTGTGGGACATGGCAAAGA
rJMFF022N19+ CTGCAATTCTGAACATGCACACCGTGAAGGGTGGAGAAAGGCTGTGGGACATGGCAAAGA
rJMFF038N17+ CTGCAATTCTGAACATGCACACCGTGAAGGGTGGAGAAAGGCTGTGGGACATGGCAAAGA
rJMFF008M15+ CTGCAATTCTGAACATGCACACCGTGAAGGGTGGAGAAAGGCTGTGGGACATGGCAAAGA
rJMFF005A08+ CTGCAATTCTGAACATGCACACCGTGAAGGGTGGAG-AAGGCTGTGGGACATGGCAAAGA
                      ____________________________________________________________
consensus CTGCAATTCTGAACATGCACACCGTGAAGGGTGGAGAAAGGCTGTGGGACATGGCAAAGA
 
. : . : . : . : . : . :
rJMFF033C02+ GAAGTTACAGTGCCTTCGAGAATTCCAAGAAAACCAACAAACATTTCTCGGACATGGCGG
rJMFF022N19+ GAAGTTACAGTGCCTTCGAGAATTCCAAGAAAACCAACAAACATTTCTCGGACATGGCGG
rJMFF038N17+ GAAGTTACAGTGCCTTCGAGAATTCCAAGAAAACCAACAAACATTTCTCGGACATGGCGG
rJMFF008M15+ GAAGTTACAGTGCCTTCGAGAATTCCAAGAAAACCAACAAACATTTCTCGGACATGGCGG
rJMFF005A08+ GAAGTTACAGTGCCTTCGAGAATTCCAAGAAAACCAACAAACATTTCTCGGACATGGCGG
                      ____________________________________________________________
consensus GAAGTTACAGTGCCTTCGAGAATTCCAAGAAAACCAACAAACATTTCTCGGACATGGCGG
 
. : . : . : . : . : . :
rJMFF033C02+ ACCTAAACTTCCTGATGTGCAAGGCCATCGACAACCCTGGTCTGACGGCGTCGTCGTCGT
rJMFF022N19+ ACCTAAACTTCCTGATGTGCAAGGCCATCGACAACCCTGGTCTGACGGCGTCGTCGTCGT
rJMFF038N17+ ACCTAAACTTCCTGATGTGCAAGGCCATCGACAACCCTGGTCTGACGGCGTCGTCGTCGT
rJMFF008M15+ ACCTAAACTTCCTGATGTGCAAGGCCATCGACAACCCTGGTCTGACGGCGTCGTCGTCGT
rJMFF005A08+ ACCTAAACTTCCTGATGTGCAAGGCCATCGACAACCCTGGTCTGACGGCGTCGTCGTCGT
                      ____________________________________________________________
consensus ACCTAAACTTCCTGATGTGCAAGGCCATCGACAACCCTGGTCTGACGGCGTCGTCGTCGT
 
. : . : . : . : . : . :
rJMFF033C02+ TGAGAAGCGCCGTTATCACGGTGTTCGAGGAGCCGGTGGTTTACGACATCAGCGCCGACA
rJMFF022N19+ TGAGAAGCGCCGTTATCACGGTGTTCGAGGAGCCGGTGGTTTACGACATCAGCGCCGACA
rJMFF038N17+ TGAGAAGCGCCGTTATCACGGTGTTCGAGGAGCCGGTGGTTTACGACATCAGCGCCGACA
rJMFF008M15+ TGAGAAGCGCCGTTATCACGGTGTTCGAGGAGCCGGTGGTTTACGACATCAGCGCCGACA
rJMFF005A08+ TGAGAAGCGCCGTTATCACGGTGTTCGAGGAGCCGGTGGTTTACGACATCAGCGCCGACA
                      ____________________________________________________________
consensus TGAGAAGCGCCGTTATCACGGTGTTCGAGGAGCCGGTGGTTTACGACATCAGCGCCGACA
 
. : . : . : . : . : . :
rJMFF033C02+ TCCAACGGGAGCTGGGCGTGGAAGACTACGTGGGGTGTTCCTCGGTTCACGGCGTGGGAC
rJMFF022N19+ TCCAACGGGAGCTGGGCGTGGAAGACTACGTGGGGTGTTCCTCGGTTCACGGCGTGGGAC
rJMFF038N17+ TCCAACGGGAGCTGGGCGTGGAAGACTACGTGGGGTGTTCCTCGGTTCACGGCGTGGGAC
rJMFF008M15+ TCCAACGGGAGCTGGGCGTGGAAGACTACGTGGGGTGTTCCTCGGTTCACGGCGTGGGAC
rJMFF005A08+ TCCAACGGGAGCTGGGCGTGGAAGACTACGTGGGGTGTTCCTCGGTTCACGGCGTGGGAC
                      ____________________________________________________________
consensus TCCAACGGGAGCTGGGCGTGGAAGACTACGTGGGGTGTTCCTCGGTTCACGGCGTGGGAC
 
. : . : . : . : . : . :
rJMFF033C02+ CGTCGATCGCCATCTTTGACACCGTGATTGACGGAAAACTGGACTGTGCATGTGTTTATC
rJMFF022N19+ CGTCGATCGCCATCTTTGACACCGTGATTGACGGAAAACTGGACTGTGCATGTGTTTATC
rJMFF038N17+ CGTCGATCGCCATCTTTGACACCGTGATTGACGGAAAACTGGACTGTGCATGTGTTTATC
rJMFF008M15+ CGTCGATCGCCATCTTTGACACCGTGATTGACGGAAAACTGGACTGTGCATGTGTTTATC
rJMFF005A08+ CGTCGATCGCCATCTTTGACACCGTGATTGACGGAAAACTGGACTGTGCATGTGTTTATC
                      ____________________________________________________________
consensus CGTCGATCGCCATCTTTGACACCGTGATTGACGGAAAACTGGACTGTGCATGTGTTTATC
 
. : . : . : . : . : . :
rJMFF033C02+ CGTCACCTTTGCATTCCAGGGAACAAATGCACGAGCTGGTTGATGAGATGAAGAGGATTC
rJMFF022N19+ CGTCACCTTTGCATTCCAGGGAACAAATGCACGAGCTGGTTGATGAGATGAAGAGGATTC
rJMFF038N17+ CGTCACCTTTGCATTCCAGGGAACAAATGCACGAGCTGGTTGATGAGATGAAGAGGATTC
rJMFF008M15+ CGTCACCTTTGCATTCCAGGGAACAAATGCACGAGCTGGTTGATGAGATGAAGAGGATTC
rJMFF005A08+ CGTCACCTTTGCATTCCAGGGAACAAATGCACGAGCTGGTTGATGAGATGAAGAGGATTC
                      ____________________________________________________________
consensus CGTCACCTTTGCATTCCAGGGAACAAATGCACGAGCTGGTTGATGAGATGAAGAGGATTC
 
. : . : . : . : . : . :
rJMFF033C02+ TTATTGATGCCACCAAATTCATTGATGATCTTAATTAATGAGATTTCTTAAGTAAAGGTC
rJMFF022N19+ TTATTGATGCCACCAAATTCATTGATGATCTTAATTAATGAGATTTCTTAAGTAAAGGTC
rJMFF038N17+ TTATTGATGCCACCAAATTCATTGATGATCTTAATTAATGAGATTTCTTAAGTAAAGGTC
rJMFF008M15+ TTATTGATGCCACCAAATTCATTGATGATCTTAATTAATGAGATTTCTTAAGTAAAGGTC
rJMFF005A08+ TTATTGATGCCACCAAATTCATTGATGATCTTAATTAATGAGATTTCTTAAGTAAAGGTC
                      ____________________________________________________________
consensus TTATTGATGCCACCAAATTCATTGATGATCTTAATTAATGAGATTTCTTAAGTAAAGGTC
 
. : . : . : . : . : . :
rJMFF033C02+ ATTAGTTGATCCAACTAAGTAATTAATATGGTAAGTTAGAGTAATGACCCATCCAGTACA
rJMFF022N19+ ATTAGTTGATCCAACTAAGTAATTAATATGGTAAGTTAGAGTAATGACCCATCCAGTACA
rJMFF038N17+ ATTAGTTGATCCAACTAAGTAATTAATATGGTAAGTTAGAGTAATGACCCATCCAGTACA
rJMFF008M15+ ATTAGTTGATCCAACTAAGTAATTAATATGGTAAGTTAGAGTAATGACCCATCCAGTACA
rJMFF005A08+ ATTAGTTGATCCAACTAAGTAATTAATATGGTAAGTTAGAGTAATGACCCATCCAGTACA
                      ____________________________________________________________
consensus ATTAGTTGATCCAACTAAGTAATTAATATGGTAAGTTAGAGTAATGACCCATCCAGTACA
 
. : . : . : . : . : . :
rJMFF033C02+ CGGGTTGTTTAGATGCATGGTAATAATCTCGACTTTTTCATGGT
rJMFF022N19+ CGGGTTGTTTAGATGCATGGTAATAATCTCGACTTTTTCATGGTTG
rJMFF038N17+ CGGGTTGTTTAGATGCATGGTAATAATCTCGACTTTTTCATGGTTGAGTTTTTAAGCTTA
rJMFF008M15+ CGGGTTGTTTAGATGCATGGTAATAATCTCGACTTTTTCATGGTTGAGTTTTTAAGCTTA
rJMFF005A08+ CGGGTTGTTTAGATGCATGGTAATAATCTCGACTTTTTCATGGTTGAGTTTTTAAGCTTA
                      ____________________________________________________________
consensus CGGGTTGTTTAGATGCATGGTAATAATCTCGACTTTTTCATGGTTGAGTTTTTAAGCTTA
 
. : . : . : . : . : . :
rJMFF038N17+ TCCCAGAGT
rJMFF008M15+ TCCCAGAGT
rJMFF005A08+ TCCCAGAGTAGTCATTTTGTTGGTGAACAATTTTATTTATTATTATTTTTTTTATCATGA
                      ____________________________________________________________
consensus TCCCAGAGTAGTCATTTTGTTGGTGAACAATTTTATTTATTATTATTTTTTTTATCATGA