Previous Contig 008355:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004P08Sequence632008355 (8)pir|G96769|G967693e-13unknown protein F9E11.1 [imported] - Arabidopsis thaliana>gb:AE005173_894961 Ara
JMFF029L14Sequence697008355 (8)pir|G96769|G967695e-25unknown protein F9E11.1 [imported] - Arabidopsis thaliana>gb:AE005173_894961 Ara
JMFF032C04Sequence494008355 (8)pir|G96769|G967696e-12unknown protein F9E11.1 [imported] - Arabidopsis thaliana>gb:AE005173_894961 Ara
JMSF007F19Sequence477002973 (5)pir|G96769|G967692e-13unknown protein F9E11.1 [imported] - Arabidopsis thaliana>gb:AE005173_894961 Ara717008355 (8)pir|H86319|H863192e-38hypothetical protein F26I16.4 - Arabidopsis thaliana>gb:AE005172_890822 Arabidop
JMSF025H23Sequence472004759 (6)315008355 (8)
JMSF035G18Sequence681002973 (5)pir|G96769|G967693e-18unknown protein F9E11.1 [imported] - Arabidopsis thaliana>gb:AE005173_894961 Ara633008355 (8)pir|H86319|H863191e-21hypothetical protein F26I16.4 - Arabidopsis thaliana>gb:AE005172_890822 Arabidop
JMSF035J18Sequence682002973 (5)pir|G96769|G967692e-18unknown protein F9E11.1 [imported] - Arabidopsis thaliana>gb:AE005173_894961 Ara580008355 (8)pir|H86319|H863193e-21hypothetical protein F26I16.4 - Arabidopsis thaliana>gb:AE005172_890822 Arabidop
JMSF051J05Sequence353004759 (6)307008355 (8)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF007F19+ CATCGGGTCAAGCATAACGGTGTTNCAGTTCCAT
                      ____________________________________________________________
consensus CATCGGGTCAAGCATAACGGTGTTNCAGTTCCAT
 
. : . : . : . : . : . :
rJMSF035G18+ GGGCAAGT
rJMSF007F19+ CCATCCGGCCTCCCAATCAATCCCGAGTTGTTTTTGGTTNTGGAGCAAACCAGGGCAAGT
                      ____________________________________________________________
consensus CCATCCGGCCTCCCAATCAATCCCGAGTTGTTTTTGGTTNTGGAGCAAACCAGGGCAAGT
 
. : . : . : . : . : . :
rJMSF035G18+ NNTTCAGNGAAGGAAGAAAATNTCNCCCAATTCAAGTCCAAAGAGAAGGTCCCCCCGTAA
rJMSF035J18+ CCAAAGAGAAGGT-CCCCCGTAA
rJMSF007F19+ ACTTCAGTGAAGGAAGAAAATATCGCCCAATTCAAGTCCAAAGAGAAGGT-CCNCCGTAA
rJMFF029L14+ CCAAAGAGAAGGT-CCNCCGTAA
                      ____________________________________________________________
consensus ACTTCAGTGAAGGAAGAAAATATCGCCCAATTCAAGTCCAAAGAGAAGGT-CCCCCGTAA
 
. : . : . : . : . : . :
rJMSF035G18+ GCTTGTTTTTGATNTCGTAAATGAAATCCNTGCTACGAAACTGGCTTTTCTTGGAACCTT
rJMSF035J18+ GCTTGTTTTTGATCTCGTAAATGAAATCCTTGCTACGAAACTGGCTTTTCTTGGAACCTT
rJMSF007F19+ GCTTGTTTTTGATNTCGTAAATGAAATCCNTGCTACGAAACTGGCTTTTCTTGGAACCTT
rJMFF029L14+ GCTTGTTTTTGATCTCGTAAATGAAATCC-TTNTACGAAACTGGCTTTTCTTGGAACCTT
                      ____________________________________________________________
consensus GCTTGTTTTTGATCTCGTAAATGAAATCCTTGCTACGAAACTGGCTTTTCTTGGAACCTT
 
. : . : . : . : . : . :
rJMSF035G18+ TTCCGAGCCGTGGGTGAAGCCCCAGAAGTTAGCGAAGAACCCCCTGAACGCNCAAAAGCT
rJMSF035J18+ TTCCGAGCCGTGGGTGAAGCCCCAGAAGTTAGCGAAGAACACCCTGAACGCNCAAAAGCT
rJMSF007F19+ TTCCGAGCCGTGGGNGAAGCCCCNGAAGTTAGCGAAGAACCCCCTGAACGCNCAAAAGCT
rJMFF029L14+ TTCCGAGCCGTGGGTGAAGCCCCAGAAGTTAGCGAAGAACACCCTGAACGCACAAAAGCT
                      ____________________________________________________________
consensus TTCCGAGCCGTGGGTGAAGCCCCAGAAGTTAGCGAAGAACCCCCTGAACGCACAAAAGCT
 
. : . : . : . : . : . :
rJMSF035G18+ ACTTAGAGAGCTGTGCTCGGAAATCGAACAGCTTCAAGCTAAATCATCCAAATNCGAGGT
rJMSF035J18+ ACTTAGAGAGCTGTGCTCGGAAATCGAACAGCTTCAAGCTAAATCATCCAAATGCGAGGT
rJMSF007F19+ ACTTAGAGAGCTGTGCTCGGAAATCGAACAGCTTCAAGCTAAATCATCCAAATGCGAGGT
rJMFF032C04+ CTCGGAAATNGANCAGCTTCAAGCTAAATCATCCAAATGCGAGGT
rJMFF029L14+ NCTTAGAGAGCTGTGCTCGGAAATCGAACAGCTTCAAGNTAAATCATCCAAATGCGAGGT
rJMFF004P08+ GAACAGCTTCAAGCTAAATCATCCAAATGCGAGGT
                      ____________________________________________________________
consensus ACTTAGAGAGCTGTGCTCGGAAATCGAACAGCTTCAAGCTAAATCATCCAAATGCGAGGT
 
. : . : . : . : . : . :
rJMSF035G18+ GGA-GGACGAGGATGATGAGCTGAAAAACATATTGTGGGAGGATGTGTTGCNCCGGTCAG
rJMSF035J18+ GGA-GGACGAGGATGATGAGCTGAAAAACNTNTTGNGGGAGGATGTGTTGCCCCGGTCAG
rJMSF007F19+ GGA-GGACGAGGATGATGAGCTGAAAAACATATTGTGGGAGGATGTGTTGCNCCGGTCNG
rJMFF032C04+ GGAGGGNCGAGGATGATGAGCTGAAAAACATATTGTGGGAGGATGTGTTGCACCGGTCAG
rJMFF029L14+ GGA-GGACGAGGATGATGAGCTGAAAAACATATTGTGGGAGGATGTGTTGCNCCGGTCAG
rJMFF004P08+ GGA-GGACGAGGATGATGAGCTGAAAAACATNTTGTGGGAGGATGTGTTGCCCCGGTCAG
                      ____________________________________________________________
consensus GGA-GGACGAGGATGATGAGCTGAAAAACATATTGTGGGAGGATGTGTTGCCCCGGTCAG
 
. : . : . : . : . : . :
rJMSF035G18+ GGAGTTGGACAGATTTCAACCNTGAAATNTCGGCTATTGTGCTTGATGTCGAGCGTTTGG
rJMSF035J18+ GGAGTTGGACAGATTTCAACCNTGAAATCTNGGCTATTGTGCTTGANGTCGAGCGTTTGG
rJMSF007F19+ GGAGTTGGACAGATTTCAACCNTGAAATNTNGGCTATTGTGCTTGATGTCGAGCGTTTGG
rJMSF051J05+ GCTTGATGTCGAGCGTTTGG
rJMFF032C04+ GGAGTTGGACAGATTTCAACCATGAAATTTCGGCTATTGTGCTTGATGTCGAGCGTTTGG
rJMFF029L14+ GGAGTTGGACAGATTTCAACCATGAAATNTCGGCTATTGTGCTTGATGTCGAGCGTTTGG
rJMFF004P08+ GGAGTTGGACAGATTTCAACCATGAAATTTNGGNTATTGTGCTTGATGTCGAGCGTTTGG
                      ____________________________________________________________
consensus GGAGTTGGACAGATTTCAACCATGAAATTTCGGCTATTGTGCTTGATGTCGAGCGTTTGG
 
. : . : . : . : . : . :
rJMSF035G18+ TCTTTAAAGACTTAATTGGCGAAATAGTGAGAGGCGAGGGCGATAACNTGAGGAACAAAC
rJMSF035J18+ TCTTTAAAGACTTAATTGGCGAAATAGTGAGAGGCGAGGGCGATAACTTGAGGAACAAAC
rJMSF007F19+ TCTTTAAAGACTTAATTGGCGAAATAGTGAGAGGCGAGGGCGATAACTTGAGGAACAAAC
rJMSF051J05+ TCTTTAAAGACTTAATTGGNGAAATAGTGAGAGGCGAGGGNGATAACTTGAGGAACAAAC
rJMFF032C04+ TCTTTAAAGACTTAATTGGCGAAATAGTGAGAGGCGAGGGCGATAACTTGAGGAACAAAC
rJMFF029L14+ TCTTTAAAGACTTAATTGGCGAAATAGTGAGAGGCGAGGGCGATAACTTGAGGAACAAAC
rJMFF004P08+ TNTTTAAAGACTTAATTGGNGAAATAGNGAGAGGNGAGGGNGATAACTTGAGGAACAAAC
                      ____________________________________________________________
consensus TCTTTAAAGACTTAATTGGCGAAATAGTGAGAGGCGAGGGCGATAACTTGAGGAACAAAC
 
. : . : . : . : . : . :
rJMSF035G18+ CNTCGAGGCGCNGGCAGTTGTTCNCAAAGTAGCTACTTTGTTTCTTTCCTCCNTTTTCAA
rJMSF035J18+ CNTCGNGGCGCNGGCNGTTGTTCNCAAAGTAGCTACTTTGTTTCTTTCCTCCNTTTTCAA
rJMSF007F19+ CNTCGAGGCGCNGGCNGTTGTTCNCAAAGTAGCTACTTTGTTTCTTTCCTCCNTTTTCAA
rJMSF051J05+ CNTNGAGGCGCAGGCAGTTGTTCNCAAAGTAGCTACTTTGTTTCTTTCCTCCNNTTTCAA
rJMFF032C04+ CATNGAGGCGCAGGCAGTTGTTCNCAAAGTAGCTACTTTGTTTCTTTCCTCCATTTTCAA
rJMSF025H23+ GTTGTTCNCAAAGNAGNTACTTTGTTTNTNTCCTCCNTTTTCAA
rJMFF029L14+ CATCGAGGCGCAGGCAGTTGTTCACAAAGTAGCTACTTTGTTTNTTTCCTCCATTTTCAA
rJMFF004P08+ CATNGAGGNGCAGGCAGTTGTTCNCAAAGTAGNTACTTTGTTTNTTTCCTCCATTTTCAA
                      ____________________________________________________________
consensus CATCGAGGCGCAGGCAGTTGTTCACAAAGTAGCTACTTTGTTTCTTTCCTCCATTTTCAA
 
. : . : . : . : . : . :
rJMSF035G18+ TGCTTCGNGTCGGTCNGTAATTTCCCNTCTCG-TTTTTTTTTTTCCCTGATTTTTATCGG
rJMSF035J18+ TGCTTCGNGTCGGTCNGTAATTTCCCNTCTCG-TTTTTTTTTTTCCCTGATTTTTATCGG
rJMSF007F19+ TGCTTCGTGTCGGTCNGTAATTTCCCNTCTCG-TTTTTTTTTTTCCCTGATTTTTATCGG
rJMSF051J05+ TGNTTCGNGTCGGTCCGTAATTNCCCNTCTCG-NTTTTTTTTTTCCCTGATTTTTATCGN
rJMFF032C04+ TGCTTCGTGTCGGTCAGTAATTTCCCATCTCG--TTTTTTTTTTCCCTGATTTTTATCGG
rJMSF025H23+ NGNTTCGNGTCGGTCNGTAATTTCCCNTCTCGNTTTTTTTTTTTCCCTGATTTTTATCGG
rJMFF029L14+ TGCTTCGTGTCGGTCAGTAATTTCCCATNTCG--TTTTTTTTTTCCCTGATTTTTATCGG
rJMFF004P08+ TGNTTNGNGTCGGTCAGTAATTTCCCATTTNG-TTTTTTTTTTTCCCTGATTTTTATCGG
                      ____________________________________________________________
consensus TGCTTCGTGTCGGTCAGTAATTTCCCATCTCG-TTTTTTTTTTTCCCTGATTTTTATCGG
 
. : . : . : . : . : . :
rJMSF035G18+ CTTTGTAATGAGTATGATTATATGAAGAACGCGAAAGTGCAG-TTGGATGGATTTTGAAG
rJMSF035J18+ CTTTGTAATGAGTATGATTATATGAAGAACGCGAAAGTGCAG-TTGGATGGATTTTGAAG
rJMSF007F19+ CTTTGTAATGAGTATGATTATATGAAGAACGCGAAAGTGCAG-TTGGATGGATTTTGAAG
rJMSF051J05+ CTTTGNGATGAGTATGATTATATGAAGAACGCGAAAGTGCAGCTTGGATGGATTTTGAAG
rJMFF032C04+ CTTTGTAATGAGTATGATTATATGAAGAACGCGAAAGTGCAG-TTGGATGGATTTTGAAG
rJMSF025H23+ CTTTGTAATGAGTATGATTATATGAAGAACGCGAAAGTGCAG-TTGGATGGATTTTGAAG
rJMFF029L14+ CTTTGTAATGAGTATGATTATATGAAGAACGCGAAAGTGCAG-TTGGATGGATTTTGAAG
rJMFF004P08+ CTTTGTAATGAGTATGATTATATGAAGAACGCGAAAGTGCAG-TTGGATGGATTTTGAAG
                      ____________________________________________________________
consensus CTTTGTAATGAGTATGATTATATGAAGAACGCGAAAGTGCAG-TTGGATGGATTTTGAAG
 
. : . : . : . : . : . :
rJMSF035G18+ GAAAATCTTTCCAGTTTCCACTCAAGTG
rJMSF035J18+ GAAAATCTTTCCAG
rJMSF007F19+ GAAAATCTTTCCAG-TTCCACTCAAGTG
rJMSF051J05+ GAAAATCTTTCCAGTTTCCACTCAAGTGTACTAAC
rJMFF032C04+ GAAAATCTTTCCAGTTTCCACTCAAGTGTACTAACAGTATACTGATAGTGATGTCAATCT
rJMSF025H23+ GAAAATCTTTCCAGTTTCCACTCAAGTGTACTAACAGTATACTGATAGTGATGTCAATCT
rJMFF029L14+ GAAAATCTTTCCAGTTTCCACTCAAGTGTACTAACAGTATACTGATAGTGATGTCAATCT
rJMFF004P08+ GAAAATCTTTCCAGTTTCCACTCAAGTGTACTAACAGTATACTGATAGTGATGTCAATCT
                      ____________________________________________________________
consensus GAAAATCTTTCCAGTTTCCACTCAAGTGTACTAACAGTATACTGATAGTGATGTCAATCT
 
. : . : . : . : . : . :
rJMFF032C04+ GTTCAAAACCACCTTGTATATCTCTTCCCAGA
rJMSF025H23+ GTTCAAAACCACCTTGTATATCTCTTCCCAGAATTCTCTTTAGCTTAGAGCTCTGAT
rJMFF029L14+ GTTCAAAACCACCTTGTATATCTCTTCCCAGAATTCTCTTTAGCTTAGAGCTCTGATTTC
rJMFF004P08+ GTTCAAAACCACCTTGTATATCTCTTCCCAGAATTCTCTTTAGCTTAGAGCTCTGATTTC
                      ____________________________________________________________
consensus GTTCAAAACCACCTTGTATATCTCTTCCCAGAATTCTCTTTAGCTTAGAGCTCTGATTTC
 
. : . : . : . : . : . :
rJMFF029L14+ CTGTCATTCAATGCTTAAAT
rJMFF004P08+ CTGTCATTCAATGCTTAAATTTGGACAGTGTGCTTCAGCTTTTCATTTCTGGTTTTATAT
                      ____________________________________________________________
consensus CTGTCATTCAATGCTTAAATTTGGACAGTGTGCTTCAGCTTTTCATTTCTGGTTTTATAT
 
. : . : . : . : . : . :
rJMFF004P08+ GAATGGCAGTGTAGTAACAGATTTGTGAATACTTCTTTCAGTAGCTCAAAATTTACAGTT
                      ____________________________________________________________
consensus GAATGGCAGTGTAGTAACAGATTTGTGAATACTTCTTTCAGTAGCTCAAAATTTACAGTT