Previous Contig 008353:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004O14Sequence467001488 (2)gb:AY062453_15651094e-43Arabidopsis thaliana nitrate transporter (NTL1) (At1g69850; T17F3.12) mRNA, comp690008353 (2)gb:AB009053_15106845e-39Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQB2.
JMFF033D09Sequence535001488 (2)gb:AY062453_15651093e-43Arabidopsis thaliana nitrate transporter (NTL1) (At1g69850; T17F3.12) mRNA, comp746008353 (2)gb:BT000720_16349934e-50Arabidopsis thaliana clone RAFL09-73-M24 (R19648) putative nitrate transporter (

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF033D09+ TGGCCATGGCC
                      ____________________________________________________________
consensus TGGCCATGGCC
 
. : . : . : . : . : . :
rJMFF033D09+ ATTGCAGCTCTTGTGGAGATGAAGAGGAAACGAGTGGCAATGCAAACTGGACTGGTGAAT
                      ____________________________________________________________
consensus ATTGCAGCTCTTGTGGAGATGAAGAGGAAACGAGTGGCAATGCAAACTGGACTGGTGAAT
 
. : . : . : . : . : . :
rJMFF033D09+ TCTAAAGAACCTCTTCCGATCACATTCCTCTGGGTGGCTTTGCAGTATTTATTCCTAGGC
rJMFF004O14+ TGGGTGGCTTTGCAGTATTTATTCCTAGGC
                      ____________________________________________________________
consensus TCTAAAGAACCTCTTCCGATCACATTCCTCTGGGTGGCTTTGCAGTATTTATTCCTAGGC
 
. : . : . : . : . : . :
rJMFF033D09+ TCAGCTGATCTCTTCAGCCTCGCTGGACTGATGGAATTCTTCTTTACAGAGGCACCATTT
rJMFF004O14+ TCAGCTGATCTCTTCAGCCTCGCTGGACTGATGGAATTCTTCTTTACAGAGGCACCATTT
                      ____________________________________________________________
consensus TCAGCTGATCTCTTCAGCCTCGCTGGACTGATGGAATTCTTCTTTACAGAGGCACCATTT
 
. : . : . : . : . : . :
rJMFF033D09+ AGCACGCGATCACTGGCAACAGCTCTCTCCTGGGCCTCACTAGCCATGGGTTACTTTCTC
rJMFF004O14+ AGCACGCGATCACTGGCAACAGCTCTCTCCTGGGCCTCACTAGCCATGGGTTACTTTCTC
                      ____________________________________________________________
consensus AGCACGCGATCACTGGCAACAGCTCTCTCCTGGGCCTCACTAGCCATGGGTTACTTTCTC
 
. : . : . : . : . : . :
rJMFF033D09+ AGTTCAGTGCTTGTATCAATTGTCAACCGCATAACTGGGACCTTTCGGCAAACACCTTGG
rJMFF004O14+ AGTTCAGTGCTTGTATCAATTGTCAACCGCATAACTGGGACCTTTCGGCAAACACCTTGG
                      ____________________________________________________________
consensus AGTTCAGTGCTTGTATCAATTGTCAACCGCATAACTGGGACCTTTCGGCAAACACCTTGG
 
. : . : . : . : . : . :
rJMFF033D09+ CTATACGGCAACAACTTAAACCATTATCATCTGGAAAGATTTTACTGGTTGATGTGCATA
rJMFF004O14+ CTATACGGCAACAACTTAAACCATTATCATCTGGAAAGATTTTACTGGTTGATGTGCATA
                      ____________________________________________________________
consensus CTATACGGCAACAACTTAAACCATTATCATCTGGAAAGATTTTACTGGTTGATGTGCATA
 
. : . : . : . : . : . :
rJMFF033D09+ CTGAGTGGATTGAATTTCTTACACTATCTCTTTTGGGCCAACCGCTACAAGTACAGATCA
rJMFF004O14+ CTGAGTGGATTGAATTTCTTACACTATCTCTTTTGGGCCAACCGCTACAAGTACAGATCA
                      ____________________________________________________________
consensus CTGAGTGGATTGAATTTCTTACACTATCTCTTTTGGGCCAACCGCTACAAGTACAGATCA
 
. : . : . : . : . : . :
rJMFF033D09+ TCCAAGCATGAAGAAGACACAAATTCAAACAATAACATGTCATAATATATAGGCTCAATA
rJMFF004O14+ TCCAAGCATGAAGAAGACACAAATTCAAACAATAACATGTCATAATATATAGGCTCAATA
                      ____________________________________________________________
consensus TCCAAGCATGAAGAAGACACAAATTCAAACAATAACATGTCATAATATATAGGCTCAATA
 
. : . : . : . : . : . :
rJMFF033D09+ ATCCTTGTCATGATGGAGCTTCCTTAGCTTCTTCACCACCCACAGTACTTCATGGTATTA
rJMFF004O14+ ATCCTTGTCATGATGGAGCTTCCTTAGCTTCTTCACCACCCACAGTACTTCATGGTATTA
                      ____________________________________________________________
consensus ATCCTTGTCATGATGGAGCTTCCTTAGCTTCTTCACCACCCACAGTACTTCATGGTATTA
 
. : . : . : . : . : . :
rJMFF033D09+ TCAGTACCTATATATCTTGATGATATATTAACAGCTCTATTTCGGTATTTTAGGCATTTA
rJMFF004O14+ TCAGTACCTATATATCTTGATGATATATTAACAGCTCTATTTCGGTATTTTAGGCATTTA
                      ____________________________________________________________
consensus TCAGTACCTATATATCTTGATGATATATTAACAGCTCTATTTCGGTATTTTAGGCATTTA
 
. : . : . : . : . : . :
rJMFF033D09+ TGCTCTTAATATTGATATATTACCATCTGCAGTTGTCTGCTTTGGAGTAATTAATCTATC
rJMFF004O14+ TGCTCTTAATATTGATATATTACCATCTGCAGTTGTCTGCTTTGGAGTAATTAATCTATC
                      ____________________________________________________________
consensus TGCTCTTAATATTGATATATTACCATCTGCAGTTGTCTGCTTTGGAGTAATTAATCTATC
 
. : . : . : . : . : . :
rJMFF033D09+ ATTGAATGGATTTGTATGCTTGTAGTACCATGGGCTCTGTAAGCCCTAGATTGATGATTT
rJMFF004O14+ ATTGAATGGATTTGTATGCTTGTAGTACCATGGGCTCTGTAAGCCCTAGATTGATGATTT
                      ____________________________________________________________
consensus ATTGAATGGATTTGTATGCTTGTAGTACCATGGGCTCTGTAAGCCCTAGATTGATGATTT
 
. : . : . : . : . : . :
rJMFF033D09+ CCTAAATGT
rJMFF004O14+ CCTAAATGTTGAAACATAATCCATATTATTATATTATATATCATTCCTACCAGTCAAAAG
                      ____________________________________________________________
consensus CCTAAATGTTGAAACATAATCCATATTATTATATTATATATCATTCCTACCAGTCAAAAG