Previous Contig 008352:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004O11Sequence571007075 (4)gb:AY087838_15728655e-41Arabidopsis thaliana clone 38849 mRNA, complete sequence.729008352 (5)pir|S60660|S606602e-17hypothetical protein - maize>gb:ZMGLOSSY_1731859 Z.mays Glossy2 locus DNA.
JMFF014K21Sequence157007075 (4)pir|T05583|T055838e-12CER2 protein - Arabidopsis thaliana>gb:ATCER2GEN_1544172 A.thaliana CER2 gene.>g769008352 (5)gb:AP001297_18209373e-19Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:F14O13.
JMFF038E08Sequence649008352 (5)pir|S60660|S606606e-18hypothetical protein - maize>gb:ZMGLOSSY_1731859 Z.mays Glossy2 locus DNA.
JMSF013F04Sequence262007075 (4)gb:OSJN00255_16974755e-09Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0070C17, complete seque767008352 (5)gb:AP001297_18209372e-21Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:F14O13.
JMSF036C08Sequence668007075 (4)gb:OSJN00088_16946866e-37Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0085I10, complete seque741008352 (5)gb:AP001297_18209373e-24Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:F14O13.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF036C08+ CCAAATGAGGTCCACAATAGGAGAC
rJMFF014K21+ GTCACAATTGGNCCAAATGAGGTCCACAATAGGAGAN
                      ____________________________________________________________
consensus GTCACAATTGGNCCAAATGAGGTCCACAATAGGAGAC
 
. : . : . : . : . : . :
rJMSF036C08+ TACGG-CCCATTTGAGTTACTCTCCGCGATCATTTGGCAGGCCGTAGCCCGGCATCGTAA
rJMFF014K21+ TACGGCCCCATTTGAGTTACTCTCCGCGATCATTTGGCAGGCCGTAGCCCGGCATCGTAA
rJMSF013F04+ CCGCGATCATTTGGCAGGCCGTAGCCCGGCATCGTAA
                      ____________________________________________________________
consensus TACGGCCCCATTTGAGTTACTCTCCGCGATCATTTGGCAGGCCGTAGCCCGGCATCGTAA
 
. : . : . : . : . : . :
rJMSF036C08+ TGGGCCTGAGCCCAAAGTGGTGACGGTTTGCAGGAAAGGCCCACAGGCCCACATCAAAGA
rJMFF014K21+ TGGGCCTGAGCCCAAAGTGGTGACGGTTTGCAGGAAAGGCCCACAGGCCCACATCAAAGA
rJMFF038E08+ CATCAAAGA
rJMSF013F04+ TGGGCCTGAGCCCAAAGTGGTGACGGTTTGCAGGAAAGGCCCACAGGCCCACATCAAAGA
rJMFF004O11+ GA
                      ____________________________________________________________
consensus TGGGCCTGAGCCCAAAGTGGTGACGGTTTGCAGGAAAGGCCCACAGGCCCACATCAAAGA
 
. : . : . : . : . : . :
rJMSF036C08+ CGGCAGTGTCGGCAACAGCCAAGC-GGTTAGTACAGTGAAACTTCGCGGCGGCGACTCCA
rJMFF014K21+ CGGCAGTGTCGGCAACAGCCAAGC-GGTTAGTACAGTGAAACTTCGCGGCGGCGACTCCA
rJMFF038E08+ CGGCAGTGTCGGCAACAGCCAAGC-GGTTAGTACAGTGAAACTTCGCGGCGGCGACTCCA
rJMSF013F04+ CGGCAGTGTCGGCAACAGCCAAGC-GGTTAGTACAGTGAAACTTCGCGGCGGCGACTCCA
rJMFF004O11+ CGGCAGTGTCGGCAACAGCCAAGCGGGTTAGTACAGTGAAACTTCGCGGCGGCGACTCCA
                      ____________________________________________________________
consensus CGGCAGTGTCGGCAACAGCCAAGC-GGTTAGTACAGTGAAACTTCGCGGCGGCGACTCCA
 
. : . : . : . : . : . :
rJMSF036C08+ TCGGAGAATCCAATCTCGCGGAGCTTGCGAGGTTGCTGAAGCATGAAGCCGCCGACGAGC
rJMFF014K21+ TCGGAGAATCCAATCTCGCGGAGCTTGCGAGGTTGCTGAAGCATGAAGCCGCCGACGAGC
rJMFF038E08+ TCGGAGAATCCAATCTCGCGGAGCTTGCGAGGTTGCTGAAGCATGAAGCCGCCGACGAGC
rJMSF013F04+ TCGGAGAATCCAATCTCGCGGAGCTTGCGAGGTTGCTGAAGCATGAAGCCGCCGACGAGC
rJMFF004O11+ TCGGAGAATCCAATCTCGCGGAGCTTGCGAGGTTGCTGAAGCATGAAGCCGCCGACGAGC
                      ____________________________________________________________
consensus TCGGAGAATCCAATCTCGCGGAGCTTGCGAGGTTGCTGAAGCATGAAGCCGCCGACGAGC
 
. : . : . : . : . : . :
rJMSF036C08+ GCCGGAAAATCGATGAGGCGATGGAGAAAGAGCGCGGCGACGCAGACGTCATCTTCTACG
rJMFF014K21+ GCCGGAAAATCGATGAGGCGATGGAGAAAGAGCGCGGCGACGCAGACGTCATCTTCTACG
rJMFF038E08+ GCCGGAAAATCGATGAGGCGATGGAGAAAGAGCGCGGCGACGCAGACGTCATCTTCTACG
rJMSF013F04+ GCCGGAAAATCGATGAGGCGATGGAGAAAGAGCGCGGCGACGCAGACGTCATCTTCTACG
rJMFF004O11+ GCCGGAAAATCGATGAGGCGATGGAGAAAGAGCGCGGCGACGCAGACGTCATCTTCTACG
                      ____________________________________________________________
consensus GCCGGAAAATCGATGAGGCGATGGAGAAAGAGCGCGGCGACGCAGACGTCATCTTCTACG
 
. : . : . : . : . : . :
rJMSF036C08+ GAGCGAATTTAACGTTCGTCGATATGGAAGACGCCGATTTCTACGGATTCGAATGGAGAG
rJMFF014K21+ GAGCGAATTTAACGTTCGTCGATATGGAAGACGCCGATTTCTACGGATTCGAATGGAGAG
rJMFF038E08+ GAGCGAATTTAACGTTCGTCGATATGGAAGACGCCGATTTCTACGGATTCGAATGGAGAG
rJMSF013F04+ GAGCGAATTTAACGTTCGTCGATATGGAAGACGCCGATTTCTACGGATTCGAATGGAGAG
rJMFF004O11+ GAGCGAATTTAACGTTCGTCGATATGGAAGACGCCGATTTCTACGGATTCGAATGGAGAG
                      ____________________________________________________________
consensus GAGCGAATTTAACGTTCGTCGATATGGAAGACGCCGATTTCTACGGATTCGAATGGAGAG
 
. : . : . : . : . : . :
rJMSF036C08+ GACAGAAGCCGGTGAAGGTAAGCTACCAAATCGATGGAGTCGGCGACGATGGCTGCGTTT
rJMFF014K21+ GACA-AAGCCGGTGAAGGTAAGCTACCAAATCGATGGAGTCGGCGACGATGGCTGCGTTT
rJMFF038E08+ GACAGAAGCCGGTGAAGGTAAGCTACCAAATCGATGGAGTCGGCGACGATGGCTGCGTTT
rJMSF013F04+ GACAGAAGCCGGTGAAGGTAAGCTACCAAATCGATGGAGTCGGCGACGATGGCTGCGTTT
rJMFF004O11+ GACAGAAGCCGGTGAAGGTAAGCTACCAAATCGATGGAGTCGGCGACGATGGCTGCGTTT
                      ____________________________________________________________
consensus GACAGAAGCCGGTGAAGGTAAGCTACCAAATCGATGGAGTCGGCGACGATGGCTGCGTTT
 
. : . : . : . : . : . :
rJMSF036C08+ TGGTGCTTCCGGCGCCGAGACATGTCGGAGAAGACGGTGCGGGAGGAAGGCTTGTGACCG
rJMFF014K21+ TGGTGCTTCCGGCGCCGAGACATGTCGGAGAAGACGGTGCGGGAGGAAGGCTTGTGACCG
rJMFF038E08+ TGGTGCTTCCGGCGCCGAGACATGTCGGAGAAGACGGTGCGGGAGGAAGGCTTGTGACCG
rJMSF013F04+ TGGTGCTTCCGGCGCCGAGACATGTCGGAGAAGACGGTGCGGGAGGAAGGCTTGTGACCG
rJMFF004O11+ TGGTGCTTCCGGCGCCGAGACATGTCGGAGAAGACGGTGCGGGAGGAAGGCTTGTGACCG
                      ____________________________________________________________
consensus TGGTGCTTCCGGCGCCGAGACATGTCGGAGAAGACGGTGCGGGAGGAAGGCTTGTGACCG
 
. : . : . : . : . : . :
rJMSF036C08+ TGATTTTGCCGGAGAATGAGGTGAAGGAGCTGAAATCGGACCTCAAAAAGGAATGGTCCA
rJMFF014K21+ TGATTTTGCCGGAGAATGAGGTGAAGGAGCTGAAATCGGACCTCAAAAAGGAATGGTCCA
rJMFF038E08+ TGATTTTGCCGGAGAATGAGGTGAAGGAGCTGAAATCGGACCTCAAAAAGGAATGGTCCA
rJMSF013F04+ TGATTTTGCCGGAGAATGAGGTGAAGGAGCTGAAATCGGACCTCAAAAAGGAATGGTCCA
rJMFF004O11+ TGATTTTGCCGGAGAATGAGGTGAAGGAGCTGAAATCGGACCTCAAAAAGGAATGGTCCA
                      ____________________________________________________________
consensus TGATTTTGCCGGAGAATGAGGTGAAGGAGCTGAAATCGGACCTCAAAAAGGAATGGTCCA
 
. : . : . : . : . : . :
rJMSF036C08+ TTGCTTGATCGAAGGAATTGAAGCTTATTTCATGGCGCTGCAGAAAAACTGAACACCAAA
rJMFF014K21+ TTGCTTGATCGAAGGAATTGAAGCTTATTTCATGGCGCTGCAGAAAAACTGAACACCAAA
rJMFF038E08+ TTGCTTGATCGAAGGAATTGAAGCTTATTTCATGGCGCTGCAGAAAAACTGAACACCAAA
rJMSF013F04+ TTGCTTGATCGAAGGAATTGAAGCTTATTTCATGGCGCTGCAGAAAAACTGAACACCAAA
rJMFF004O11+ TTGCTTGATCGAAGGAATTGAAGCTTATTTCATGGCGCTGCAGAAAAACTGAACACCAAA
                      ____________________________________________________________
consensus TTGCTTGATCGAAGGAATTGAAGCTTATTTCATGGCGCTGCAGAAAAACTGAACACCAAA
 
. : . : . : . : . : . :
rJMSF036C08+ GGCCGCCATTGTTATGCAGAGTTAATCCTTAGGTAAGCGAGCTTTACCGTTTTACCAAAC
rJMFF014K21+ GGCCGCCATTGTTATGCAGAGTTAATCCTTAGGTAAGCGAGCTTTACCGTTTTACCAAAC
rJMFF038E08+ GGCCGCCATTGTTATGCAGAGTTAATCCTTAGGTAAGCGAGCTTTACCGTTTTACCAAAC
rJMSF013F04+ GGCCGCCATTGTTATGCAGAGTTAATCCTTAGGTAAGCGAGCTTTACCGTTTTACCAAAC
rJMFF004O11+ GGCCGCCATTGTTATGCAGAGTTAATCCTTAGGTAAGCGAGCTTTACCGTTTTACCAAAC
                      ____________________________________________________________
consensus GGCCGCCATTGTTATGCAGAGTTAATCCTTAGGTAAGCGAGCTTTACCGTTTTACCAAAC
 
. : . : . : . : . : . :
rJMSF036C08+ TTATCTCATAGAAGTGATATGGTGTATTGCTGATCTTAAAAGTTGTACTAGTGTGT
rJMFF014K21+ TTATCTCATAGAAGTGATATGGTGTATTGCTGATCTTAAAAGTTGTACTAGTGTGTTGTT
rJMFF038E08+ TTATCTCATAGAAGTGATATGGTGTATTGCTGATCTTAAAAGTTGTACTAGTGTGTTGTT
rJMSF013F04+ TTATCTCATAGAAGTGATATGGTGTATTGCTGATCTTAAAAGTTGTACTAGTGTGTTGTT
rJMFF004O11+ TTATCTCATAGAAGTGATATGGTGTATTGCTGATCTTAAAAGTTGTACTAGTGTGTTGTT
                      ____________________________________________________________
consensus TTATCTCATAGAAGTGATATGGTGTATTGCTGATCTTAAAAGTTGTACTAGTGTGTTGTT
 
. : . : . : . : . : . :
rJMFF014K21+ TTCTTTGAACACTG
rJMFF038E08+ TTCTTTGAACACTGTTTGTATTCATGCTATGTTGCCTACTT
rJMSF013F04+ TTCTTTGAACACTGTTTGTATTCATGCTATGTTGCCTACTTGCCTTCTACCAATGGTTTT
rJMFF004O11+ TTCTTTGAACACTGTTTGTATTCATGCTATGTTGCCTACTTGCCTTCTA-CAATGGTTTT
                      ____________________________________________________________
consensus TTCTTTGAACACTGTTTGTATTCATGCTATGTTGCCTACTTGCCTTCTACCAATGGTTTT
 
. : . : . : . : . : . :
rJMSF013F04+ GTTATAGATGA
rJMFF004O11+ GTTATAGATGATATAAAATTTTGAATTTGTTTTACATAGTATTCTAAGATANCAAAAAGA
                      ____________________________________________________________
consensus GTTATAGATGATATAAAATTTTGAATTTGTTTTACATAGTATTCTAAGATANCAAAAAGA