Previous Contig 008347:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004M18Sequence592007440 (7)pir|T07734|T077344e-14homeotic protein VAHOX1 - tomato>gb:LEVAHOX1G_1684803 L.esculentum mRNA for home674008347 (7)pir|T07734|T077341e-22homeotic protein VAHOX1 - tomato>gb:LEVAHOX1G_1684803 L.esculentum mRNA for home
JMFF014K04Sequence476005035 (3)gb:NTEC32139_16915498e-55N. tabacum mRNA for acidic beta-1,3 glucanase (PR-Q').760008347 (7)gb:VVI277900_17275162e-76Vitis vinifera mRNA for beta 1-3 glucanase (g1 gene).
JMFF037B11Sequence587007440 (7)pir|T07734|T077344e-14homeotic protein VAHOX1 - tomato>gb:LEVAHOX1G_1684803 L.esculentum mRNA for home720008347 (7)pir|T07734|T077341e-22homeotic protein VAHOX1 - tomato>gb:LEVAHOX1G_1684803 L.esculentum mRNA for home
JMSF008G14Sequence451013171 (6)gb:AB009050_15106324e-26Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDF20.>gb:BT001996_1635743008347 (7)pir|T07734|T077342e-23homeotic protein VAHOX1 - tomato>gb:LEVAHOX1G_1684803 L.esculentum mRNA for home
JMSF041L17Sequence726007440 (7)gb:AB009050_15106322e-40Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDF20.>gb:BT001996_1635732008347 (7)pir|T07734|T077342e-23homeotic protein VAHOX1 - tomato>gb:LEVAHOX1G_1684803 L.esculentum mRNA for home
JMSF047I09Sequence400007440 (7)759008347 (7)pir|T07734|T077342e-32homeotic protein VAHOX1 - tomato>gb:LEVAHOX1G_1684803 L.esculentum mRNA for home
JMSF048D22Sequence611007440 (7)758008347 (7)pir|T07734|T077341e-36homeotic protein VAHOX1 - tomato>gb:LEVAHOX1G_1684803 L.esculentum mRNA for home

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF014K04+ CCAGGCTGCAATTTCTGGGGCTGGATTGGGGACCAGGATTAAGGTTTCCACAGCT
                      ____________________________________________________________
consensus CCAGGCTGCAATTTCTGGGGCTGGATTGGGGACCAGGATTAAGGTTTCCACAGCT
 
. : . : . : . : . : . :
rJMFF014K04+ GTGGAAACAGGACTTTTAGGAGTTGGCTATCCTCCTTCTCAGGGAGATTTCAAGCCTGAT
                      ____________________________________________________________
consensus GTGGAAACAGGACTTTTAGGAGTTGGCTATCCTCCTTCTCAGGGAGATTTCAAGCCTGAT
 
. : . : . : . : . : . :
rJMFF014K04+ GTTAGGACATTCATCAACCCCATAATCACATTCCTAGTGAACAACAATGCCCCGCTACTC
                      ____________________________________________________________
consensus GTTAGGACATTCATCAACCCCATAATCACATTCCTAGTGAACAACAATGCCCCGCTACTC
 
. : . : . : . : . : . :
rJMFF014K04+ GTAAACATTTACCCCTACATTGCATACATAGAAAACACAAAGGATATTAAGCTTGAGTAT
                      ____________________________________________________________
consensus GTAAACATTTACCCCTACATTGCATACATAGAAAACACAAAGGATATTAAGCTTGAGTAT
 
. : . : . : . : . : . :
rJMFF014K04+ GCACTTTTCACATCACCTGGAATTGTAGTTAACGATGGCCCGGGCTACCAAAACCTCTTC
                      ____________________________________________________________
consensus GCACTTTTCACATCACCTGGAATTGTAGTTAACGATGGCCCGGGCTACCAAAACCTCTTC
 
. : . : . : . : . : . :
rJMFF014K04+ GATGCTCTTTTAGATGCCATGTACTCGGCTCTCGAAAGGGCTGGTGGCTCATCTCTGGAG
                      ____________________________________________________________
consensus GATGCTCTTTTAGATGCCATGTACTCGGCTCTCGAAAGGGCTGGTGGCTCATCTCTGGAG
 
. : . : . : . : . : . :
rJMFF014K04+ ATTGTTGTATCTGAGAGCGGTTGGCCCTCTTTTGGGGGAGATGCAGCCTCCATTGACAAT
                      ____________________________________________________________
consensus ATTGTTGTATCTGAGAGCGGTTGGCCCTCTTTTGGGGGAGATGCAGCCTCCATTGACAAT
 
. : . : . : . : . : . :
rJMFF014K04+ GCCAGGACATACAACAACAATCTCATACGCCATGTGAAGGGAGGGAGCCCTAAGAGGCCT
                      ____________________________________________________________
consensus GCCAGGACATACAACAACAATCTCATACGCCATGTGAAGGGAGGGAGCCCTAAGAGGCCT
 
. : . : . : . : . : . :
rJMFF014K04+ CAAAAAGCTATAGAGACTTACATTTTCGATTTGTTTAATGAAGACCAGAAGGATCCTCCT
                      ____________________________________________________________
consensus CAAAAAGCTATAGAGACTTACATTTTCGATTTGTTTAATGAAGACCAGAAGGATCCTCCT
 
. : . : . : . : . : . :
rJMFF014K04+ GAAACTGAGAGGCATTTTGGTCTGTTCTTTCCAAACAGGCAACCAAAATACCCCATCAGC
                      ____________________________________________________________
consensus GAAACTGAGAGGCATTTTGGTCTGTTCTTTCCAAACAGGCAACCAAAATACCCCATCAGC
 
. : . : . : . : . : . :
rJMFF014K04+ TTTAACTAGTCATCGAGACTCGAGTTTATCAAGCAACTAATAATATGGTAATGTAAATTG
                      ____________________________________________________________
consensus TTTAACTAGTCATCGAGACTCGAGTTTATCAAGCAACTAATAATATGGTAATGTAAATTG
 
. : . : . : . : . : . :
rJMFF014K04+ AAGCATGTGCTCCATCTCAACTAAAAGCTTAAGCTAATAGTTGGATTGCACATTAATGGT
rJMSF008G14+ AACTAAAAGCCTAAGCTGATAGTTGGATTGCACATTAATGGT
                      ____________________________________________________________
consensus AAGCATGTGCTCCATCTCAACTAAAAGCTTAAGCTGATAGTTGGATTGCACATTAATGGT
 
. : . : . : . : . : . :
rJMFF014K04+ TATATGCTCAACA
rJMSF048D22+ TTCTTCGCGTCACGG
rJMSF008G14+ TATATGCTCAACACAATAAGTTTAGCTTGTGTTTGTTTGCCCAGGTTCTTCGCGTCACGG
rJMSF041L17+ AGGTTCTTCGCGTCACGG
rJMFF037B11+ TTCTTCGCGTCACGG
rJMSF047I09+ TTCTTCGCGTCACGG
rJMFF004M18+ TCTTCGCGTCACGG
                      ____________________________________________________________
consensus TATATGCTCAACACAATAAGTTTAGCTTGTGTTTGTTTGCCCAGGTTCTTCGCGTCACGG
 
. : . : . : . : . : . :
rJMSF048D22+ ACAAGCTAGTTGTGAAGGGTAAAGAAAAGGAAACGTTAAAGTTTCGAGATGATATCCAAC
rJMSF008G14+ ACAAGCTAGTTGTGAAGGGTAAAGAAAAGGAAACGTTAAAGTTTCGAGATGATATCCAAC
rJMSF041L17+ ACAAGCTAGTTGTGAAGGGTAAAGAAAAGGAAACGTTAAAGTTTCGAGATGATATCCAAC
rJMFF037B11+ ACAAGCTAGTTGTGAAGGGTAAAGAAAAGGAAACGTTAAAGTTTCGAGATGATATCCAAC
rJMSF047I09+ ACAAGCTAGTTGTGAAGGGTAAAGAAAAGGAAACGTTAAAGTTTCGAGATGATATCCAAC
rJMFF004M18+ ACAAGCTAGTTGTGAAGGGTAAAGAAAAGGAAACGTTAAAGTTTCGAGATGATATCCAAC
                      ____________________________________________________________
consensus ACAAGCTAGTTGTGAAGGGTAAAGAAAAGGAAACGTTAAAGTTTCGAGATGATATCCAAC
 
. : . : . : . : . : . :
rJMSF048D22+ ACCCTTTGGAAGCACTGTCGAAAGACCATATGGCTGATTCAGTTGCAGCATCATCCCCAG
rJMSF008G14+ ACCCTTTGGAAGCACTGTCGAAAGACCATATGGCTGATTCAGTTGCAGCATCATCCCCAG
rJMSF041L17+ ACCCTTTGGAAGCACTGTCGAAAGACCATATGGCTGATTCAGTTGCAGCATCATCCCCAG
rJMFF037B11+ ACCCTTTGGAAGCACTGTCGAAAGACCATATGGCTGATTCAGTTGCAGCATCATCCCCAG
rJMSF047I09+ ACCCTTTGGAAGCACTGTCGAAAGACCATATGGCTGATTCAGTTGCAGCATCATCCCCAG
rJMFF004M18+ ACCCTTTGGAAGCACTGTCGAAAGACCATATGGCTGATTCAGTTGCAGCATCATCCCCAG
                      ____________________________________________________________
consensus ACCCTTTGGAAGCACTGTCGAAAGACCATATGGCTGATTCAGTTGCAGCATCATCCCCAG
 
. : . : . : . : . : . :
rJMSF048D22+ CCCTGCCTGTTAAGCTGGAAGGTACAAGCCCGAGTAAGAGCGACGTGTTGGATTCAGACA
rJMSF008G14+ CCCTGCCTGTTAAGCTGGAAGGTACAAGCCCGAGTAAGAGCGACGTGTTGGATTCAGACA
rJMSF041L17+ CCCTGCCTGTTAAGCTGGAAGGTACAAGCCCGAGTAAGAGCGACGTGTTGGATTCAGACA
rJMFF037B11+ CCCTGCCTGTTAAGCTGGAAGGTACAAGCCCGAGTAAGAGCGACGTGTTGGATTCAGACA
rJMSF047I09+ CCCTGCCTGTTAAGCTGGAAGGTACAAGCCCGAGTAAGAGCGACGTGTTGGATTCAGACA
rJMFF004M18+ CCCTGCCTGTTAAGCTGGAAGGTACAAGCCCGAGTAAGAGCGACGTGTTGGATTCAGACA
                      ____________________________________________________________
consensus CCCTGCCTGTTAAGCTGGAAGGTACAAGCCCGAGTAAGAGCGACGTGTTGGATTCAGACA
 
. : . : . : . : . : . :
rJMSF048D22+ GCCCTCGCTACACCGATGGGGTTCACTCGTCTTTTCCCGACATCGGGGGGGACTCTTCCT
rJMSF008G14+ GCCCTCGCTACACCGATGGGGTTCACTCGTCTTTTCCCGACATCGGGGGGGACTCTTCCT
rJMSF041L17+ GCCCTCGCTACACCGATGGGGTTCACTCGTCTTTTCCCGACATCGGGGGGGACTCTTCCT
rJMFF037B11+ GCCCTCGCTACACCGATGGGGTTCACTCGTCTTTTCCCGACATCGGGGGGGACTCTTCCT
rJMSF047I09+ GCCCTCGCTACACCGATGGGGTTCACTCGTCTTTTCCCGACATCGGGGGGGACTCTTCCT
rJMFF004M18+ GCCCTCGCTACACCGATGGGGTTCACTCGTCTTTTCCCGACATCGGGGGGGACTCTTCCT
                      ____________________________________________________________
consensus GCCCTCGCTACACCGATGGGGTTCACTCGTCTTTTCCCGACATCGGGGGGGACTCTTCCT
 
. : . : . : . : . : . :
rJMSF048D22+ ATGTCTTCGAGCCAGAGCGGTCAGACTCAGATTTATCACAAGACGAAGACGATAGGTTCA
rJMSF008G14+ ATGTCTTCGAGCCAGAGCGGTCAGACTCAGATTTATCACAAGACGAAGACGATAGGTTCA
rJMSF041L17+ ATGTCTTCGAGCCAGAGCGGTCAGACTCAGATTTATCACAAGACGAAGACGATAGGTTCA
rJMFF037B11+ ATGTCTTCGAGCCAGAGCGGTCAGACTCAGATTTATCACAAGACGAAGACGATAGGTTCA
rJMSF047I09+ ATGTCTTCGAGCCAGAGCGGTCAGACTCAGATTTATCACAAGACGAAGACGATAGGTTCA
rJMFF004M18+ ATGTCTTCGAGCCAGAGCGGTCAGACTCAGATTTATCACAAGACGAAGACGATAGGTTCA
                      ____________________________________________________________
consensus ATGTCTTCGAGCCAGAGCGGTCAGACTCAGATTTATCACAAGACGAAGACGATAGGTTCA
 
. : . : . : . : . : . :
rJMSF048D22+ GCAAGAATTTCATGGCTGCTTCGGAGTCGTTGTCTGTGTTCCCAAAGGTCAGAGAAGATC
rJMSF008G14+ GCAAGAATTTCATGGCTGCTTCGGAGTCGTTGTCTGTGTTCCCAAAGGTCAGAGAAGATC
rJMSF041L17+ GCAAGAATTTCATGGCTGCTTCGGAGTCGTTGTCTGTGTTCCCAAAGGTCAGAGAAGATC
rJMFF037B11+ GCAAGAATTTCATGGCTGCTTCGGAGTCGTTGTCTGTGTTCCCAAAGGTCAGAGAAGATC
rJMSF047I09+ GCAAGAATTTCATGGCTGCTTCGGAGTCGTTGTCTGTGTTCCCAAAGGTCAGAGAAGATC
rJMFF004M18+ GCAAGAATTTCATGGCTGCTTCGGAGTCGTTGTCTGTGTTCCCAAAGGTCAGAGAAGATC
                      ____________________________________________________________
consensus GCAAGAATTTCATGGCTGCTTCGGAGTCGTTGTCTGTGTTCCCAAAGGTCAGAGAAGATC
 
. : . : . : . : . : . :
rJMSF048D22+ ATTACCCCATAGCCATACCTCCCACCAATTCATCCTTGTATGGATTCCCAGTTGAAGATC
rJMSF008G14+ ATTACCCCATAGCCATACCTCCCACCAATTCATCCTTGTATGGATTCCCAGTTGAAGATC
rJMSF041L17+ ATTACCCCATAGCCATACCTCCCACCAATTCATCCTTGTATGGATTCCCAGTTGAAGATC
rJMFF037B11+ ATTACCCCATAGCCATACCTCCCACCAATTCATCCTTGTATGGATTCCCAGTTGAAGATC
rJMSF047I09+ ATTACCCCATAGCCATACCTCCCACCAATTCATCCTTGTATGGATTCCCAGTTGAAGATC
rJMFF004M18+ ATTACCCCATAGCCATACCTCCCACCAATTCATCCTTGTATGGATTCCCAGTTGAAGATC
                      ____________________________________________________________
consensus ATTACCCCATAGCCATACCTCCCACCAATTCATCCTTGTATGGATTCCCAGTTGAAGATC
 
. : . : . : . : . : . :
rJMSF048D22+ AAACCTTTGGGTTTTGGCCTTATTAAGCTGCAATTACTCGTTGACTTGGTGAATTTATGG
rJMSF008G14+ AAACCTTTGGGTTTTGGCCTTATTAAGCTGCAATTACTCGTTGACTTGGTGGATTTATGG
rJMSF041L17+ AAACCTTTGGGTTTTGGCCTTATTAAGCTGCAATTACTCGTTGACTTGGTGGATTTATGG
rJMFF037B11+ AAACCTTTGGGTTTTGGCCTTATTAAGCTGCAATTACTCGTTGACTTGGTGAATTTATGG
rJMSF047I09+ AAACCTTTGGGTTTTGGCCTTATTAAGCTGCAATTACTCGTTGACTTGGTGAATTTATGG
rJMFF004M18+ AAACCTTTGGGTTTTGGCCTTATTAAGCTGCAATTACTCGTTGACTTGGTGAATTTATGG
                      ____________________________________________________________
consensus AAACCTTTGGGTTTTGGCCTTATTAAGCTGCAATTACTCGTTGACTTGGTGAATTTATGG
 
. : . : . : . : . : . :
rJMSF048D22+ CCTGCAGGGACATAGGTGATGTTCCTTATAAAATGGCACCAAGTTAGCAAGTAATACCAT
rJMSF008G14+ CCTGCAGGGACATAGGTGATGTTCCTTATAAAATGGCACCAAGTTAGCAAGTAATACCAT
rJMSF041L17+ CCTGCAGGGACATAGGTGATGTTCCTTATAAAATGGCACCAAGTTAGCAAGTAATACCAT
rJMFF037B11+ CCTGCAGGGACATAGGTGATGTTCCTTATAAAATGGCACCAAGTTAGCAAGTAATACCAT
rJMSF047I09+ CCTGCAGGGACATAGGTGATGTTCCTTATAAAATGGCACCAAGTTAGCAAGTAATACCAT
rJMFF004M18+ CCTGCAGGGACATAGGTGATGTTCCTTATAAAATGGCACCAAGTTAGCAAGTAATACCAT
                      ____________________________________________________________
consensus CCTGCAGGGACATAGGTGATGTTCCTTATAAAATGGCACCAAGTTAGCAAGTAATACCAT
 
. : . : . : . : . : . :
rJMSF048D22+ ACTGTCCACACTGTCCATTCATGTATTATTGTATATTAGTTTGTGTCAACAGCAATAAAA
rJMSF008G14+ ACTGTCCACACTGTCCATTCATGTATTATTGTATATTAGTTTGTGTCAACAGCAATAAAA
rJMSF041L17+ ACTGTCCACACTGTCCATTCATGTATTATTGTATATTAGTTTGTGTCAACAGCAATAAAA
rJMFF037B11+ ACTGTCCACACTGTCCATTCATGTATTATTGTATATTAGTTTGTGTCAACAGCAATAAAA
rJMSF047I09+ ACTGTCCACACTGTCCATTCATGTATTATTGTATATTAGTTTGTGTCAACAGCAATAAAA
rJMFF004M18+ ACTGTCCACACTGTCCATTCATGTATTATTGTATATTAGTTTGTGTCAACAGCAATAAAA
                      ____________________________________________________________
consensus ACTGTCCACACTGTCCATTCATGTATTATTGTATATTAGTTTGTGTCAACAGCAATAAAA
 
. : . : . : . : . : . :
rJMSF048D22+ AATCCAATCAGGAATTGGAAACCATGTAATGTTACACTT
rJMSF008G14+ AATCCAATCAGGAATTGGAAACCATGTAATGTTACACTT
rJMSF041L17+ AATCCAATCAGGAATTGGAAACCATGTAATGTTACACTT
rJMFF037B11+ AATCCAATCAGGAATTGGAAACCATGTAATGTTACACTTTGTAGTAGTACTGCTTTCAA
rJMSF047I09+ AATCCAATCAGGAATTGGAAACCATGTAATGTTACACTTTGTAGTAGTACTGCTTTCAA
rJMFF004M18+ AATCCAATCAGGAATTGGAAACCATGTAATGTTACACTTTGTAGTAGTACTGCTTTCAAT
                      ____________________________________________________________
consensus AATCCAATCAGGAATTGGAAACCATGTAATGTTACACTTTGTAGTAGTACTGCTTTCAAT