Previous Contig 008342:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004L02Sequence795008342 (2)gb:AY124859_15802244e-65Arabidopsis thaliana AT4g39690/T19P19_80 mRNA, complete cds.>gb:BT000714_1634988
JMFF027O11Sequence602001301 (2)gb:AY124859_15802245e-11Arabidopsis thaliana AT4g39690/T19P19_80 mRNA, complete cds.>gb:BT000714_1634988697008342 (2)gb:AY124859_15802244e-61Arabidopsis thaliana AT4g39690/T19P19_80 mRNA, complete cds.>gb:BT000714_1634988

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF004L02+ TGAAGCAAATCTTCA
                      ____________________________________________________________
consensus TGAAGCAAATCTTCA
 
. : . : . : . : . : . :
rJMFF027O11+ TTTCTATGCACGCTCCGAAGAAGCTAGGCAGACTCATTC
rJMFF004L02+ TATAAATGCCTTGTGTATGGCTTTCTATGCACGCTCCGAAGAAGCTAGGCAGACTCATTC
                      ____________________________________________________________
consensus TATAAATGCCTTGTGTATGGCTTTCTATGCACGCTCCGAAGAAGCTAGGCAGACTCATTC
 
. : . : . : . : . : . :
rJMFF027O11+ TGTTCACAAGCTTGCTTTGGGAGCACTTGCATTGGAGGATTCCCTGTCCAAAGGGCTACC
rJMFF004L02+ TGTTCACAAGCTTGCTTTGGGAGCACTTGCATTGGAGGATTCCCTGTCCAAAGGGCTACC
                      ____________________________________________________________
consensus TGTTCACAAGCTTGCTTTGGGAGCACTTGCATTGGAGGATTCCCTGTCCAAAGGGCTACC
 
. : . : . : . : . : . :
rJMFF027O11+ AATTCAGAATGAAATAGAAGCTCTGCATCCTTATCTTAAAGGGATTGATAAAGACTCTCT
rJMFF004L02+ AATTCAGAATGAAATAGAAGCTCTGCATCCTTATCTTAAAGGGATTGATAAAGACTCTCT
                      ____________________________________________________________
consensus AATTCAGAATGAAATAGAAGCTCTGCATCCTTATCTTAAAGGGATTGATAAAGACTCTCT
 
. : . : . : . : . : . :
rJMFF027O11+ TCTAGAGTTAGTCCTTTCTTCTCTTCCTGAAGAAACACAGAAGTATGGTAGTGATACTTT
rJMFF004L02+ TCTAGAGTTAGTCCTTTCTTCTCTTCCTGAAGAAACACAGAAGTATGGTAGTGATACTTT
                      ____________________________________________________________
consensus TCTAGAGTTAGTCCTTTCTTCTCTTCCTGAAGAAACACAGAAGTATGGTAGTGATACTTT
 
. : . : . : . : . : . :
rJMFF027O11+ ATTGCAACTGAATCACAAGTTTGATGCCTTGAAAGGATCTCTACGACACTTCAGTCTGAT
rJMFF004L02+ ATTGCAACTGAATCACAAGTTTGATGCCTTGAAAGGATCTCTACGACACTTCAGTCTGAT
                      ____________________________________________________________
consensus ATTGCAACTGAATCACAAGTTTGATGCCTTGAAAGGATCTCTACGACACTTCAGTCTGAT
 
. : . : . : . : . : . :
rJMFF027O11+ TCCCCCGGGGGGAGGTGGGATTTTGACACATTCTTTGGCTTTGGTTGCATCTTGGTTAAA
rJMFF004L02+ TCCCCCGGGGGGAGGTGGGATTTTGACACATTCTTTGGCTTTGGTTGCATCTTGGTTAAA
                      ____________________________________________________________
consensus TCCCCCGGGGGGAGGTGGGATTTTGACACATTCTTTGGCTTTGGTTGCATCTTGGTTAAA
 
. : . : . : . : . : . :
rJMFF027O11+ GGTTAGACAGGTTGACAAATCCGGTGATGGTATTGAATCTCTCATTAATAGAGTAGAGAT
rJMFF004L02+ GGTTAGACAGGTTGACAAATCCGGTGATGGTATTGAATCTCTCATTAATAGAGTAGAGAT
                      ____________________________________________________________
consensus GGTTAGACAGGTTGACAAATCCGGTGATGGTATTGAATCTCTCATTAATAGAGTAGAGAT
 
. : . : . : . : . : . :
rJMFF027O11+ CTTGTTAGCCGAGGATAAACTAATTGAAGCTGCAGATGAACTCGAGAAGGGCGTCAAGGG
rJMFF004L02+ CTTGTTAGCCGAGGATAAACTAATTGAAGCTGCAGATGAACTCGAGAAGGGCGTCAAGGG
                      ____________________________________________________________
consensus CTTGTTAGCCGAGGATAAACTAATTGAAGCTGCAGATGAACTCGAGAAGGGCGTCAAGGG
 
. : . : . : . : . : . :
rJMFF027O11+ CACTCAAGCCGCCGAAGTGGTTGATGAATGGATCAGGCGTGCTAGAAACAGAGCTATCAC
rJMFF004L02+ CACTCAAGCCGCCGAAGTGGTTGATGAATGGATCAGGCGTGCTAGAAACAGAGCTATCAC
                      ____________________________________________________________
consensus CACTCAAGCCGCCGAAGTGGTTGATGAATGGATCAGGCGTGCTAGAAACAGAGCTATCAC
 
. : . : . : . : . : . :
rJMFF027O11+ CGATCAAGCTCTAACCCTATTGCAAGCTTATGCCACTACCATCAGTCTAACCTGAACTTC
rJMFF004L02+ CGATCAAGCTCTAACCCTATTGCAAGCTTATGCCACTACCATCAGTCTAACCTGAACTTC
                      ____________________________________________________________
consensus CGATCAAGCTCTAACCCTATTGCAAGCTTATGCCACTACCATCAGTCTAACCTGAACTTC
 
. : . : . : . : . : . :
rJMFF027O11+ ATAACCCACTATTCTCTCTATTCACATTTTGGCTCATAACATTTAGTTTTCCCTTCTATA
rJMFF004L02+ ATAACCCACTATTCTCTCTATTCACATTTTGGCTCATAACATTTAGTTTTCCCTTCTATA
                      ____________________________________________________________
consensus ATAACCCACTATTCTCTCTATTCACATTTTGGCTCATAACATTTAGTTTTCCCTTCTATA
 
. : . : . : . : . : . :
rJMFF027O11+ TTTTGCCTTGACAAAGCTCGGCCTTCAATAAGTAACATATGTGAATTTCGCAGTACAC
rJMFF004L02+ TTTTGCCTTGACAAAGCTCGGCCTTCAATAAGTAACATATGTGAATTTCGCAGTACACTG
                      ____________________________________________________________
consensus TTTTGCCTTGACAAAGCTCGGCCTTCAATAAGTAACATATGTGAATTTCGCAGTACACTG
 
. : . : . : . : . : . :
rJMFF004L02+ AATTAAATAAAACCGTAGTTGAAACATAACAAATTTTTGTATGACAGATTCATATAGAGG
                      ____________________________________________________________
consensus AATTAAATAAAACCGTAGTTGAAACATAACAAATTTTTGTATGACAGATTCATATAGAGG