Previous Contig 008339:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004J19Sequence490008339 (2)gb:AP003866_18345431e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10
JMSF030C14Sequence653019607pir|F85225|F852251e-44hypothetical protein AT4g19900 [imported] - Arabidopsis thaliana>gb:ATCHRIV51_15733008339 (2)pir|F85225|F852253e-34hypothetical protein AT4g19900 [imported] - Arabidopsis thaliana>gb:ATCHRIV51_15

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF030C14+ CTGACATCATAGNGTTGAACCANCTTTCTTCACT
                      ____________________________________________________________
consensus CTGACATCATAGNGTTGAACCANCTTTCTTCACT
 
. : . : . : . : . : . :
rJMSF030C14+ TAATAATACTGNTGGCATGGATGAAGGGATGGATGGAAACACTTTGAGTGGCGCTGTGAT
                      ____________________________________________________________
consensus TAATAATACTGNTGGCATGGATGAAGGGATGGATGGAAACACTTTGAGTGGCGCTGTGAT
 
. : . : . : . : . : . :
rJMSF030C14+ GGCATTCAGAAAGCATAGTCCCTTTATAATGGAGTGTTTGAATGAGTTCTATTCATCATA
                      ____________________________________________________________
consensus GGCATTCAGAAAGCATAGTCCCTTTATAATGGAGTGTTTGAATGAGTTCTATTCATCATA
 
. : . : . : . : . : . :
rJMSF030C14+ TGATGACTCACAATTGAGGTGGAATGGAGCCGAGCTTTTGATTAGAGTTGCTTAACTTTT
                      ____________________________________________________________
consensus TGATGACTCACAATTGAGGTGGAATGGAGCCGAGCTTTTGATTAGAGTTGCTTAACTTTT
 
. : . : . : . : . : . :
rJMSF030C14+ CAAGTAATGATAATGTCTCCAACAAAAATATGGAGCTTAGATTGCAACCATCCTCTCTTT
                      ____________________________________________________________
consensus CAAGTAATGATAATGTCTCCAACAAAAATATGGAGCTTAGATTGCAACCATCCTCTCTTT
 
. : . : . : . : . : . :
rJMSF030C14+ TCTTCCCAATAAGTCATGGCAATATTCTAAGATACTTAACTGCACCAGTTACAGAAAGTG
rJMFF004J19+ ACAGAAAGTG
                      ____________________________________________________________
consensus TCTTCCCAATAAGTCATGGCAATATTCTAAGATACTTAACTGCACCAGTTACAGAAAGTG
 
. : . : . : . : . : . :
rJMSF030C14+ AAAGATCTGAACAAGATGCTCTCTTTAAAAAGATCCNTGATGAGTCTCTCACATTTCACT
rJMFF004J19+ AAAGATTTGAACAAGATGCTNTCTTTAAAAAGATCCNTGANGAGTNTTTCNCNTTTCACT
                      ____________________________________________________________
consensus AAAGATTTGAACAAGATGCTCTCTTTAAAAAGATCCNTGATGAGTCTTTCACATTTCACT
 
. : . : . : . : . : . :
rJMSF030C14+ TATGGAATAGCATAACCTCAGCCACTGTTCCAGAGCCTAACAGCCTTGTAGCCCGGATTA
rJMFF004J19+ TATGGAATAGCATNACCTCAGCCACTGTTCCAGANCCTNACANCCTTGTAGCCCGGATTA
                      ____________________________________________________________
consensus TATGGAATAGCATAACCTCAGCCACTGTTCCAGAGCCTAACAGCCTTGTAGCCCGGATTA
 
. : . : . : . : . : . :
rJMSF030C14+ TAAATCATCACTGTCTTCACTGCTCCGAAGAATTGTAGTATACACAGTAAGCGATCGTTC
rJMFF004J19+ TAAATCATCACTGTNTTCACTGCTCCGAAGAATTGTAGTATNCNCAGTAAGCGATNGTTC
                      ____________________________________________________________
consensus TAAATCATCACTGTCTTCACTGCTCCGAAGAATTGTAGTATACACAGTAAGCGATCGTTC
 
. : . : . : . : . : . :
rJMSF030C14+ ATGGCTTCGTTGAATGCTTCTATACTTGCTCCGCTGAATTCCTAGTAAACGGAAACATTA
rJMFF004J19+ ATGGNTTCGTTGAATGCTTNTATACTTGCTCCGGTGAATTCCTAGTNAACGGAAACATTA
                      ____________________________________________________________
consensus ATGGCTTCGTTGAATGCTTCTATACTTGCTCCGGTGAATTCCTAGTAAACGGAAACATTA
 
. : . : . : . : . : . :
rJMSF030C14+ CGAGCTGGTTGATTAATGCATTATGCTGTACAGTCGAAATTGCCCNTGGATTTTGGCAAG
rJMFF004J19+ CGAGCTGGTTGANTAATGCATTATGCTGTACAGTNGAAATTGCCCTTGGATTTTGGCAAG
                      ____________________________________________________________
consensus CGAGCTGGTTGATTAATGCATTATGCTGTACAGTCGAAATTGCCCTTGGATTTTGGCAAG
 
. : . : . : . : . : . :
rJMSF030C14+ TCTTTGCTATGGTGATGGCATCTTGAGTTCCAAGTAGCTTTGTGAGAAATGTGATGCTTT
rJMFF004J19+ TCTTTGCTATGGNGANGGCATNTTGAGTTCCAAGTAGCTTTGTGAGAAATGTGATGCTTT
                      ____________________________________________________________
consensus TCTTTGCTATGGTGATGGCATCTTGAGTTCCAAGTAGCTTTGTGAGAAATGTGATGCTTT
 
. : . : . : . : . : . :
rJMSF030C14+ GGATGGAGGTTGTAATAGGTTTTTTTT
rJMFF004J19+ GGATGGANGTTGTAATAGGTTTTTTTTTTGACAAGTCATGTAAAGTATTATTTTTATTTT
                      ____________________________________________________________
consensus GGATGGAGGTTGTAATAGGTTTTTTTTTTGACAAGTCATGTAAAGTATTATTTTTATTTT
 
. : . : . : . : . : . :
rJMFF004J19+ GAAGAAAGAGTTCACCATATAGAGAGATATGATTGAAATTAAAATGGAAAATATTTACAT
                      ____________________________________________________________
consensus GAAGAAAGAGTTCACCATATAGAGAGATATGATTGAAATTAAAATGGAAAATATTTACAT