Previous Contig 008337:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004J10Sequence436006793 (2)762008337 (2)gb:AY072114_15670081e-83Arabidopsis thaliana unknown protein (At3g62660) mRNA, complete cds.>gb:AY096607
JMSF032B17Sequence531006793 (2)677008337 (2)gb:AY072114_15670088e-90Arabidopsis thaliana unknown protein (At3g62660) mRNA, complete cds.>gb:AY096607

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032B17+ TCGGAATT
                      ____________________________________________________________
consensus TCGGAATT
 
. : . : . : . : . : . :
rJMSF032B17+ ATTTGGCGGGTATGCTGGAGCCCTGCGTACGCAGAGTTATATACTTGGATTCTGATCTGG
                      ____________________________________________________________
consensus ATTTGGCGGGTATGCTGGAGCCCTGCGTACGCAGAGTTATATACTTGGATTCTGATCTGG
 
. : . : . : . : . : . :
rJMSF032B17+ TTGTGGTGGACGATATTTCCAAGCTATGGACTACAAACTTGGGGGACAAGACCATCGGAG
rJMFF004J10+ CCAAGCTATGGACTACAAACTTGGGGGACAAGACCATCGGAG
                      ____________________________________________________________
consensus TTGTGGTGGACGATATTTCCAAGCTATGGACTACAAACTTGGGGGACAAGACCATCGGAG
 
. : . : . : . : . : . :
rJMSF032B17+ CTCCGGAGTACTGTCACGCCAACTTCACCAAGTACTTCACCTCTAATTTCTGGTCGGACC
rJMFF004J10+ CTCCGGAGTACTGTCACGCCAACTTCACCAAGTACTTCACCTCTAATTTCTGGTCGGACC
                      ____________________________________________________________
consensus CTCCGGAGTACTGTCACGCCAACTTCACCAAGTACTTCACCTCTAATTTCTGGTCGGACC
 
. : . : . : . : . : . :
rJMSF032B17+ GGAGTTTATACGCTACGTTCGCCGGCCGGAAACCGTGCTACTTCAACACAGGCGTTATGG
rJMFF004J10+ GGAGTTTATACGCCACGTTCGCCGGCCGGAAACCGTGCTACTTCAACACCGGCGTTATGG
                      ____________________________________________________________
consensus GGAGTTTATACGCTACGTTCGCCGGCCGGAAACCGTGCTACTTCAACACCGGCGTTATGG
 
. : . : . : . : . : . :
rJMSF032B17+ TCATAGATCTAGCGAAATGGAGGCGGTTGGGGTACACCAAGCGTATTGAGAGGTGGATGG
rJMFF004J10+ TCATAGATCTAGCGAAATGGAGGCGGTTGGGGTACACCAAGCGTATTGAGAGGTGGATGG
                      ____________________________________________________________
consensus TCATAGATCTAGCGAAATGGAGGCGGTTGGGGTACACCAAGCGTATTGAGAGGTGGATGG
 
. : . : . : . : . : . :
rJMSF032B17+ AGATCCAGAAGACGAACCGGATCTACGAATTGGGGTCACTGCCGCCATTCCTGCTAGTGT
rJMFF004J10+ AGATCCAGAAGACGAACCGGATCTACGAATTGGGGTCACTGCCGCCATTCCTGCTAGTGT
                      ____________________________________________________________
consensus AGATCCAGAAGACGAACCGGATCTACGAATTGGGGTCACTGCCGCCATTCCTGCTAGTGT
 
. : . : . : . : . : . :
rJMSF032B17+ TTGCGGGAGAAGTGGCGCCCATTGAGCACAGGTGGAACCAGCACGGTTTGGGCGGCGATA
rJMFF004J10+ TTGCGGGAGAAGTGGCGCCCATTGAGCACAGGTGGAACCAGCACGGTTTGGGCGGCGATA
                      ____________________________________________________________
consensus TTGCGGGAGAAGTGGCGCCCATTGAGCACAGGTGGAACCAGCACGGTTTGGGCGGCGATA
 
. : . : . : . : . : . :
rJMSF032B17+ ATGTACGAGGAAGCTGCCGGAACCTCCACCCTGGTCCGGTGAGTCTCCTCCACTGGAGCG
rJMFF004J10+ ATGTACGAGGAAGCTGCCGGAACCTCCACCCTGGTCCGGTGAGTCTCCTCCACTGGAGCG
                      ____________________________________________________________
consensus ATGTACGAGGAAGCTGCCGGAACCTCCACCCTGGTCCGGTGAGTCTCCTCCACTGGAGCG
 
. : . : . : . : . : . :
rJMSF032B17+ GCAGCGGCAAGCCGTGGCTGAGGCTGGACTCCAGGAAGCCATGCCCGCTTGACTCTCTAT
rJMFF004J10+ GCAGCGGCAAGCCGTGGCTGAGGCTGGACTCCAGGAAGCCATGCCCGCTTGACTCTCTAT
                      ____________________________________________________________
consensus GCAGCGGCAAGCCGTGGCTGAGGCTGGACTCCAGGAAGCCATGCCCGCTTGACTCTCTAT
 
. : . : . : . : . : . :
rJMSF032B17+ GGGCACCGTACGACCTCCATGGACATTCAACGTGAACTCAACTCCTCTACTGTTATCTCG
rJMFF004J10+ GGGCACCGTACGACCTCCATGGACATTCAACGTGAACTCAACTCCTCTACTGTTATCTCG
                      ____________________________________________________________
consensus GGGCACCGTACGACCTCCATGGACATTCAACGTGAACTCAACTCCTCTACTGTTATCTCG
 
. : . : . : . : . : . :
rJMSF032B17+ CCGGTAAATTCCTAGTCAGTCTAAATTTCTTTTGTTTCCCGTCTCTTTGAATTTTCTGGT
rJMFF004J10+ CCGGTAAATTCCTAGTCAGTCTAAATTTCTTTTGTTTCCCGTCTCTTTGAATTTTCTGGT
                      ____________________________________________________________
consensus CCGGTAAATTCCTAGTCAGTCTAAATTTCTTTTGTTTCCCGTCTCTTTGAATTTTCTGGT
 
. : . : . : . : . : . :
rJMSF032B17+ CGACATCT
rJMFF004J10+ CGACATCTTCATTTCTCCATTAATTTTTGTCAGTCTTTTCTTATATTCAGAATTTTTTTC
                      ____________________________________________________________
consensus CGACATCTTCATTTCTCCATTAATTTTTGTCAGTCTTTTCTTATATTCAGAATTTTTTTC
 
. : . : . : . : . : . :
rJMFF004J10+ TCTTGATTTTTTTTGGCATTTGGATTAAAATATAGCTCCATTATTATATGATGATGAGAG
                      ____________________________________________________________
consensus TCTTGATTTTTTTTGGCATTTGGATTAAAATATAGCTCCATTATTATATGATGATGAGAG
 
. : . : . : . : . : . :
rJMFF004J10+ AGGATTTGTATTCTATTCATCCGCACTCTGCTCTCTGAATTCGAAAAAAAGGGGAAAATC
                      ____________________________________________________________
consensus AGGATTTGTATTCTATTCATCCGCACTCTGCTCTCTGAATTCGAAAAAAAGGGGAAAATC