Previous Contig 008329:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004G18Sequence496006489 (2)gb:AY207043_15895562e-35Oryza sativa (indica cultivar-group) abcisic acid-inducible protein kinanase mRN726008329 (2)gb:AF178575_17747185e-72Vitis vinifera putative serine/threonine kinase GDBrPK (GDBrPK) mRNA, partial cd
JMSF027M22Sequence650006489 (2)gb:AY207043_15895562e-30Oryza sativa (indica cultivar-group) abcisic acid-inducible protein kinanase mRN731008329 (2)gb:AF178575_17747183e-71Vitis vinifera putative serine/threonine kinase GDBrPK (GDBrPK) mRNA, partial cd

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF027M22+ TATAGCCCCGCG
rJMFF004G18+ CCCGCG
                      ____________________________________________________________
consensus TATAGCCCCGCG
 
. : . : . : . : . : . :
rJMSF027M22+ NGTCAAAATANGNGATTTTGGGTACTCTAAGTCAGATGTGTTTCATTCTCAACCTAAATC
rJMFF004G18+ TGTCAAAATATGTGATTTTGGGTACTCTAAGTCAGATGTGTTTCATTCTCAACCTAAATC
                      ____________________________________________________________
consensus TGTCAAAATATGTGATTTTGGGTACTCTAAGTCAGATGTGTTTCATTCTCAACCTAAATC
 
. : . : . : . : . : . :
rJMSF027M22+ AACTGTGGGAACACCCGCTTATGTTGCTCCCGAGGTCCTATCAAGGAAAGAATATGATGG
rJMFF004G18+ AACTGTGGGAACACCCGCTTATGTTGCTCCCGAGGTCCTATCAAGGAAAGAATATGATGG
                      ____________________________________________________________
consensus AACTGTGGGAACACCCGCTTATGTTGCTCCCGAGGTCCTATCAAGGAAAGAATATGATGG
 
. : . : . : . : . : . :
rJMSF027M22+ GAAGCTTGCAGATATCTGGTCTTGTGGTGTCACATTGTATGTGATGTTGGTTGGAGCCTA
rJMFF004G18+ GAAGCTTGCAGATATCTGGTCTTGTGGTGTCACATTGTATGTGATGTTGGTTGGAGCCTA
                      ____________________________________________________________
consensus GAAGCTTGCAGATATCTGGTCTTGTGGTGTCACATTGTATGTGATGTTGGTTGGAGCCTA
 
. : . : . : . : . : . :
rJMSF027M22+ TCCTTTTGAAGATCCAAGTGATCCAAAAAATTTCAGAAAGACCATTGTTAAAATACTCGG
rJMFF004G18+ TCCTTTTGAAGATCCAAGTGATCCAAAAAATTTCAGAAAGACCATTGTTAAGATACTCGG
                      ____________________________________________________________
consensus TCCTTTTGAAGATCCAAGTGATCCAAAAAATTTCAGAAAGACCATTGTTAAGATACTCGG
 
. : . : . : . : . : . :
rJMSF027M22+ TGTCCAATACTCCATTCCTGATAATATTCGCATTTCTGTTGAGTGCCGGCATCTTCTGTC
rJMFF004G18+ TGTCCAATACTCCATTCCTGATAATATTCGCATTTCTGTTGAGTGCCGGCATCTTCTGTC
                      ____________________________________________________________
consensus TGTCCAATACTCCATTCCTGATAATATTCGCATTTCTGTTGAGTGCCGGCATCTTCTGTC
 
. : . : . : . : . : . :
rJMSF027M22+ AAGAATTTTTGTGGCTAACCCTGAAGAGAGAATAACCATTCCTGAAATAAGAAGGCACCC
rJMFF004G18+ AAGAATTTTTGTGGCTAACCCTGAAGAGAGAATAACCATTCCTGAAATAAGAAGGCACCC
                      ____________________________________________________________
consensus AAGAATTTTTGTGGCTAACCCTGAAGAGAGAATAACCATTCCTGAAATAAGAAGGCACCC
 
. : . : . : . : . : . :
rJMSF027M22+ ATGGTTTCTGAAGAACTTGCCTGTAGAACTGATGGATGGAGGGAGCTATCAGTGCATGGA
rJMFF004G18+ ATGGTTTCTGAAGAACTTGCCTGTAGAACTGATGGATGGAGGGAGCTATCAGTGCATGGA
                      ____________________________________________________________
consensus ATGGTTTCTGAAGAACTTGCCTGTAGAACTGATGGATGGAGGGAGCTATCAGTGCATGGA
 
. : . : . : . : . : . :
rJMSF027M22+ TGTAAATAATCCTTCCCAAAGCATGGAGGAAATATCGTCGATAATTCAGGAGGCAAGAAC
rJMFF004G18+ TGTAAATAATCCTTCCCAAAGCATGGAGGAAATATCGTCGATAATTCAGGAGGCAAGAAC
                      ____________________________________________________________
consensus TGTAAATAATCCTTCCCAAAGCATGGAGGAAATATCGTCGATAATTCAGGAGGCAAGAAC
 
. : . : . : . : . : . :
rJMSF027M22+ AGTGGTTCAGTTGCCCAGAACTCGAACGTATTCTTTTGGTGGGAGCATGGAACTTGACGA
rJMFF004G18+ AGTGGTTCAGTTGCCCAGAACTCGAACGTATTCTTTTGGTGGGAGCATGGAACTTGACGA
                      ____________________________________________________________
consensus AGTGGTTCAGTTGCCCAGAACTCGAACGTATTCTTTTGGTGGGAGCATGGAACTTGACGA
 
. : . : . : . : . : . :
rJMSF027M22+ TTTGGATGATGCTGATATTGAAGATATAGAAACAAGTGGTGACTTTGTGTCTGAGTTGTG
rJMFF004G18+ TTTGGATGATGCTGATATTGAAGATATAGAAACAAGTGGTGACTTTGTGTCTGAGTTGTG
                      ____________________________________________________________
consensus TTTGGATGATGCTGATATTGAAGATATAGAAACAAGTGGTGACTTTGTGTCTGAGTTGTG
 
. : . : . : . : . : . :
rJMSF027M22+ ATGGGAACCACAACTATAGACAAAAAAAAACAACAAATCTTTTAACAGAGGTGTTGTCCC
rJMFF004G18+ ATGGGAACCACAACTATAGACAAAAAAAAACAACAAATCTTTTAACAGAGGTGTTGTCCC
                      ____________________________________________________________
consensus ATGGGAACCACAACTATAGACAAAAAAAAACAACAAATCTTTTAACAGAGGTGTTGTCCC
 
. : . : . : . : . : . :
rJMSF027M22+ AAGATTTTCTCAGTGGTTAACTTGCTTGTTGTGTAACATTTGTGTTTATAA
rJMFF004G18+ AAGATTTTCTCAGTGGTTAACTTGCTTGTTGTGTAACATTTGTGTTTATAAGGAAAAAAC
                      ____________________________________________________________
consensus AAGATTTTCTCAGTGGTTAACTTGCTTGTTGTGTAACATTTGTGTTTATAAGGAAAAAAC