Previous Contig 008327:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004G03Sequence509000195 (2)gb:AE005173_8934654e-53Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC002304_153743008327 (2)gb:OSJN00023_16934617e-38Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0016O02, complete seque
JMFF009F10Sequence542000195 (2)gb:AE005173_8934655e-55Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC002304_153746008327 (2)gb:OSJN00023_16934617e-38Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0016O02, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF009F10+ TTGCTCAAGCATGCAGTCATCTCGGAG
rJMFF004G03+ TCAAGCATGCAGTCATCTCGGAG
                      ____________________________________________________________
consensus TTGCTCAAGCATGCAGTCATCTCGGAG
 
. : . : . : . : . : . :
rJMFF009F10+ TTGATTTCAAGACACATTCACCCCCACTTGGTCTAGCTGACGAAAAGAAACTTCAAAACT
rJMFF004G03+ TTGATTTCAAGACACATTCACCCCCACTTGGTCTAGCTGACGAAAAGAAACTTCAAAACT
                      ____________________________________________________________
consensus TTGATTTCAAGACACATTCACCCCCACTTGGTCTAGCTGACGAAAAGAAACTTCAAAACT
 
. : . : . : . : . : . :
rJMFF009F10+ ACATCAATCTTCTCTATCTTAGTTGGGTTAGTGGAGACATCGTTGATCTGAGAACTGGAA
rJMFF004G03+ ACATCAATCTTCTCTATCTTAGTTGGGTTAGTGGAGACATCGTTGATCTGAGAACTGGAA
                      ____________________________________________________________
consensus ACATCAATCTTCTCTATCTTAGTTGGGTTAGTGGAGACATCGTTGATCTGAGAACTGGAA
 
. : . : . : . : . : . :
rJMFF009F10+ AGCGGAATGCAGACTGTTTGTCTTCTAGCAATCTCAAAAGTCAGTCCGGGGAAATTCCGT
rJMFF004G03+ AGCGGAATGCAGACTGTTTGTCTTCTAGCAATCTCAAAAGTCAGTCCGGGGAAATTCCGT
                      ____________________________________________________________
consensus AGCGGAATGCAGACTGTTTGTCTTCTAGCAATCTCAAAAGTCAGTCCGGGGAAATTCCGT
 
. : . : . : . : . : . :
rJMFF009F10+ TTCAAAACATTGTTCTCTTGTGGGGCTTACCATCTAATCTAAAACCATCTGACATTAGAG
rJMFF004G03+ TTCAAAACATTGTTCTCTTGTGGGGCTTACCATCTAATCTAAAACCATCTGACATTAGAG
                      ____________________________________________________________
consensus TTCAAAACATTGTTCTCTTGTGGGGCTTACCATCTAATCTAAAACCATCTGACATTAGAG
 
. : . : . : . : . : . :
rJMFF009F10+ ATTGCATATCAAGAGTTTTTGGTCAAAACTCAGCTCCTTCCATCTACTTCATAGATAAAA
rJMFF004G03+ ATTGCATATCAAGAGTTTTTGGTCAAAACTCAGCTCCTTCCATCTACTTCATAGATAAAA
                      ____________________________________________________________
consensus ATTGCATATCAAGAGTTTTTGGTCAAAACTCAGCTCCTTCCATCTACTTCATAGATAAAA
 
. : . : . : . : . : . :
rJMFF009F10+ CTGCTGCCTTTGTTCAGTTCAGCAAAACAGAAATGGCAACCTCGTTCCTCGACACAATGG
rJMFF004G03+ CTGCTGCCTTTGTTCAGTTCAGCAAAACAGAAATGGCAACCTCGTTCCTCGACACAATGG
                      ____________________________________________________________
consensus CTGCTGCCTTTGTTCAGTTCAGCAAAACAGAAATGGCAACCTCGTTCCTCGACACAATGG
 
. : . : . : . : . : . :
rJMFF009F10+ AAACTTTAGGGAGGAGCAATGATCCAATATCAGTTTTGCATCCTCTCTCAAGACTTCTGG
rJMFF004G03+ AAACTTTAGGGAGGAGCAATGATCCAATATCAGTTTTGCATCCTCTCTCAAGACTTCTGG
                      ____________________________________________________________
consensus AAACTTTAGGGAGGAGCAATGATCCAATATCAGTTTTGCATCCTCTCTCAAGACTTCTGG
 
. : . : . : . : . : . :
rJMFF009F10+ AGGGTGGTTGCACACATGCTGCAAACTATGAAGTATACAGACAAATTTGCAGTTCACCCC
rJMFF004G03+ AGGGTGGTTGCACACATGCTGCAAACTATGAAGTATACAGACAAATTTGCAGTTCACCCC
                      ____________________________________________________________
consensus AGGGTGGTTGCACACATGCTGCAAACTATGAAGTATACAGACAAATTTGCAGTTCACCCC
 
. : . : . : . : . : . :
rJMFF009F10+ TTTCGAAAGTCTTATTTGCAGATCAGGCCGAAGCCATCCGAACCAAAGGAGTATGTGAAG
rJMFF004G03+ TTTCGAAAGTCTTATTTGCAGATCAGGCCGAAGCCATCCGAACCAAAGGAGTATGTGAAG
                      ____________________________________________________________
consensus TTTCGAAAGTCTTATTTGCAGATCAGGCCGAAGCCATCCGAACCAAAGGAGTATGTGAAG
 
. : . : . : . : . : . :
rJMFF009F10+ TTTCAAAGGCTAATAAAGTAGAGGAAATGATAGAAGATGAAAAACACACAACTTTTGCCC
rJMFF004G03+ TTTCAAAGGCTAATAAAGTAGAGGAAATGATAGAAGATGAAAAACACACAACTTTTGCCC
                      ____________________________________________________________
consensus TTTCAAAGGCTAATAAAGTAGAGGAAATGATAGAAGATGAAAAACACACAACTTTTGCCC
 
. : . : . : . : . : . :
rJMFF009F10+ AGAGCTGTATATAATCAATCCCTCCTTTGTGTTTTAATAGAATTTTTTGTTTTCATTCTA
rJMFF004G03+ AGAGCTGTATATAATCAATCCCTCCTTTGTGTTTTAATAGAATTTTTTGTTTTCATTCTA
                      ____________________________________________________________
consensus AGAGCTGTATATAATCAATCCCTCCTTTGTGTTTTAATAGAATTTTTTGTTTTCATTCTA
 
. : . : . : . : . : . :
rJMFF009F10+ AGATATGTTATACTTGATTTGAAACTCTGTACAATGTAAAAGG-TGGAGAACAACACCAT
rJMFF004G03+ AGATATGTTATACTTGATTTGAAACTCTGTACAATGTAAAAGGTTGGAGAACAACACCAT
                      ____________________________________________________________
consensus AGATATGTTATACTTGATTTGAAACTCTGTACAATGTAAAAGGTTGGAGAACAACACCAT