Previous Contig 008326:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004G02Sequence575003971 (3)pir|T02627|T026274e-32hypothetical protein At2g25960 [imported] - Arabidopsis thaliana>gb:AC004747_153693008326 (3)pir|T02627|T026273e-06hypothetical protein At2g25960 [imported] - Arabidopsis thaliana>gb:AC004747_153
JMFN018K06Sequence479008326 (3)gb:BA000030_7004300.028Streptomyces avermitilis MA-4680 genomic DNA, complete genome.
JMSF039J01Sequence606007293 (6)pir|T02627|T026278e-27hypothetical protein At2g25960 [imported] - Arabidopsis thaliana>gb:AC004747_153871008326 (3)gb:AP004779_18449775e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P047

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039J01+ CAGGTCAGCCAAATCCTGTTTCCTGGATATGATCAGCAACAGGGTTATAATTCA
                      ____________________________________________________________
consensus CAGGTCAGCCAAATCCTGTTTCCTGGATATGATCAGCAACAGGGTTATAATTCA
 
. : . : . : . : . : . :
rJMSF039J01+ ACAACTGGGTATAGTAATACTTCCAACACAGCAGCAGCAGATGGCCACACGCCTTCATTC
                      ____________________________________________________________
consensus ACAACTGGGTATAGTAATACTTCCAACACAGCAGCAGCAGATGGCCACACGCCTTCATTC
 
. : . : . : . : . : . :
rJMSF039J01+ GGGACCCAGAGTGATACAAGTCAAGCACCTCCAAATCAGTCAGCAGCCAGCCAACCTGGG
                      ____________________________________________________________
consensus GGGACCCAGAGTGATACAAGTCAAGCACCTCCAAATCAGTCAGCAGCCAGCCAACCTGGG
 
. : . : . : . : . : . :
rJMSF039J01+ TACCATACTTCCCAGCATCCTAGCCCTAATGCCAATTACCAGCATCAAGGAACAACTCAG
                      ____________________________________________________________
consensus TACCATACTTCCCAGCATCCTAGCCCTAATGCCAATTACCAGCATCAAGGAACAACTCAG
 
. : . : . : . : . : . :
rJMSF039J01+ CCAGGGTATGGCATACCAACTTCACAAGGTGGATATGGGACTCAGCCACCTGCATATGGC
rJMFF004G02+ CAAGGTGGATATGGGACACAGCCACCTGCCTATGGC
                      ____________________________________________________________
consensus CCAGGGTATGGCATACCAACTTCACAAGGTGGATATGGGACTCAGCCACCTGCCTATGGC
 
. : . : . : . : . : . :
rJMSF039J01+ ACCAATTATGGGCAGCCCCCGTCTCAAAAGCCCCCGACTAGTCAACCAGCTTACGGGCAG
rJMFF004G02+ AACAACTATGGACAACCCCCATCTCAAAAGCCTCCAACTAGTCAACCAGCTTACGG---T
                      ____________________________________________________________
consensus ACCAATTATGGGCAGCCCCCGTCTCAAAAGCCTCCGACTAGTCAACCAGCTTACGGGCAT
 
. : . : . : . : . : . :
rJMSF039J01+ CAGCCGCAACAGTCACCTAGTGCCCAGGGAGGTTATGCACAGCCCCCTCAGGTATATCCT
rJMFF004G02+ CAGCCCCAACAGTCACCTAGTGCCCAGGGAGGTTATGCACAGCCCCCTCAGGTATATCCA
                      ____________________________________________________________
consensus CAGCCGCAACAGTCACCTAGTGCCCAGGGAGGTTATGCACAGCCCCCTCAGGTATATCCT
 
. : . : . : . : . : . :
rJMSF039J01+ CACTCTCAGCCTTTACCTGCTGTAACTGGTTATTCTCAGCCTGATTCTGGTTCCCAGCGT
JMFN018K06- TCTCAGCCTGATTCTGGTTCCCAGCAT
rJMFF004G02+ CACTCTCAGCCTTCACCTACTCTATCTGGTTATTCTCAGCCTGATTCTGGTTCTCAGCGT
                      ____________________________________________________________
consensus CACTCTCAGCCTTTACCTGCTGTATCTGGTTATTCTCAGCCTGATTCTGGTTCCCAGCGT
 
. : . : . : . : . : . :
rJMSF039J01+ CCTACCTCTACTGGATATGGT------GCAACCCAACCGGGTTATGGCCCCCCAGCCTAT
JMFN018K06- GCTCCCTCTACTGGATATGGTGCCCCGGCAAGTCAACCGGGTTATGGCCCCCCACCCTAT
rJMFF004G02+ GCTCCCTCTACTGGATATGGTGCCCCGGCAAGTCAACCGGGTTATGGCCCTCCATCGTAT
                      ____________________________________________________________
consensus GCTCCCTCTACTGGATATGGTGCCCCGGCAAGTCAACCGGGTTATGGCCCCCCATCCTAT
 
. : . : . : . : . : . :
rJMSF039J01+ GGAGCTCCACCAATGACTCAATCGGGAGTGTCATACAATAGTGGGTATGGTGGTAATAGT
JMFN018K06- GGGGCGCCACAGATGACTCAATCAGGAGTGCCATACAATAGTGGTTATGGTGGTAGTGGT
rJMFF004G02+ GGGGCACCACAGATGACTCAATCAGGAGTGCCATACAATAGTGGATATGGTGGTAGTGGT
                      ____________________________________________________________
consensus GGGGCTCCACAGATGACTCAATCAGGAGTGCCATACAATAGTGGTTATGGTGGTAGTGGT
 
. : . : . : . : . : . :
rJMSF039J01+ TATTCTCAGCCTTCAGCATACTCCACCGATGGAAG---TGGTGGTGGTGCACGAGCAACA
JMFN018K06- TATTCCCAGGCTTCAGCATACTCCACTGATGGAAGTGCTGGTGGTGGTGCACGGGCGAGC
rJMFF004G02+ TATTCCCAGGCTTCAGCATACTCCACTGATGGAAGTGGTGGTGGTGGTGCACCTGCGAGC
                      ____________________________________________________________
consensus TATTCCCAGGCTTCAGCATACTCCACTGATGGAAGTGGTGGTGGTGGTGCACGTGCGAGC
 
. : . : . : . : . : . :
rJMSF039J01+ TATGATACAGCACCAACTTCTCAGTCTTCCCAGCCCACAGGGTCGGCTAAAACCTCTCCA
JMFN018K06- TATGATACAGCACCAACTTCTCAGTCTTCCCAGCCCACTGGGTCAGCTAAAACCTCTCCA
rJMFF004G02+ TATGATACAGCACCAACTTCTCAGTCCTCCCAGCCCACTGGGTCGGCAAAAACCTCTCCA
                      ____________________________________________________________
consensus TATGATACAGCACCAACTTCTCAGTCTTCCCAGCCCACTGGGTCGGCTAAAACCTCTCCA
 
. : . : . : . : . : . :
rJMSF039J01+ GAGAGTTGAT
JMFN018K06- CAGAGTTGATTT
rJMFF004G02+ CAGAGTTGATATCTTTGACTTAAATGGTGGTTATGAATTTTGCATGTACTTTGGTTATGT
                      ____________________________________________________________
consensus CAGAGTTGATTTCTTTGACTTAAATGGTGGTTATGAATTTTGCATGTACTTTGGTTATGT
 
. : . : . : . : . : . :
rJMFF004G02+ TCTGCATTTTAGTTTCTTGATCCTTTGAATGTAGAATTAATTTGTTGTGATATCTGTTTT
                      ____________________________________________________________
consensus TCTGCATTTTAGTTTCTTGATCCTTTGAATGTAGAATTAATTTGTTGTGATATCTGTTTT
 
. : . : . : . : . : . :
rJMFF004G02+ CTTATCTTAACTCTAATTGCAGTATGACTCTATGTTTCATAATTTGTGGTTCTCAATCTA
                      ____________________________________________________________
consensus CTTATCTTAACTCTAATTGCAGTATGACTCTATGTTTCATAATTTGTGGTTCTCAATCTA
 
. : . : . : . : . : . :
rJMFF004G02+ TGTTTATTCTTGTAAGGGAAAAAGGGTCAAATAGATCCAAAAACATTATAGAAAGAGCAA
                      ____________________________________________________________
consensus TGTTTATTCTTGTAAGGGAAAAAGGGTCAAATAGATCCAAAAACATTATAGAAAGAGCAA