Previous Contig 008320:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004E22Sequence592000189 (25)gb:AF049870_17641022e-81Arabidopsis thaliana beta tubulin 1, thaumatin-like protein (TL1), small hydroph725008320 (13)gb:AY422690_16053523e-74Nicotiana attenuata tissue-type shoot beta-tubulin (TUB) mRNA, complete cds.
JMFF008J07Sequence246008320 (13)gb:AY422690_16053522e-37Nicotiana attenuata tissue-type shoot beta-tubulin (TUB) mRNA, complete cds.
JMFF013G23Sequence544000189 (25)gb:AF049870_17641028e-72Arabidopsis thaliana beta tubulin 1, thaumatin-like protein (TL1), small hydroph731008320 (13)gb:AY422690_16053522e-83Nicotiana attenuata tissue-type shoot beta-tubulin (TUB) mRNA, complete cds.
JMFF019F12Sequence590000189 (25)gb:AF049870_17641029e-83Arabidopsis thaliana beta tubulin 1, thaumatin-like protein (TL1), small hydroph711008320 (13)gb:AY422690_16053521e-73Nicotiana attenuata tissue-type shoot beta-tubulin (TUB) mRNA, complete cds.
JMFF023E23Sequence500000189 (25)gb:AF049870_17641021e-71Arabidopsis thaliana beta tubulin 1, thaumatin-like protein (TL1), small hydroph663008320 (13)gb:AY422690_16053522e-79Nicotiana attenuata tissue-type shoot beta-tubulin (TUB) mRNA, complete cds.
JMFF023L17Sequence534000189 (25)gb:AF049870_17641021e-71Arabidopsis thaliana beta tubulin 1, thaumatin-like protein (TL1), small hydroph789008320 (13)gb:AY422690_16053522e-96Nicotiana attenuata tissue-type shoot beta-tubulin (TUB) mRNA, complete cds.
JMFF029P04Sequence178000189 (25)gb:AF049870_17641021e-13Arabidopsis thaliana beta tubulin 1, thaumatin-like protein (TL1), small hydroph673008320 (13)gb:AY422690_16053527e-80Nicotiana attenuata tissue-type shoot beta-tubulin (TUB) mRNA, complete cds.
JMFF034E11Sequence176000189 (25)gb:AY422690_16053521e-11Nicotiana attenuata tissue-type shoot beta-tubulin (TUB) mRNA, complete cds.669008320 (13)gb:AY422690_16053522e-78Nicotiana attenuata tissue-type shoot beta-tubulin (TUB) mRNA, complete cds.
JMFF036D04Sequence532000189 (25)gb:AF049870_17641021e-71Arabidopsis thaliana beta tubulin 1, thaumatin-like protein (TL1), small hydroph665008320 (13)gb:AY422690_16053522e-77Nicotiana attenuata tissue-type shoot beta-tubulin (TUB) mRNA, complete cds.
JMFF045A06Sequence656000189 (25)gb:AF049870_17641021e-61Arabidopsis thaliana beta tubulin 1, thaumatin-like protein (TL1), small hydroph646008320 (13)gb:AY422690_16053521e-69Nicotiana attenuata tissue-type shoot beta-tubulin (TUB) mRNA, complete cds.
JMFF046F07Sequence549000189 (25)gb:AF049870_17641023e-65Arabidopsis thaliana beta tubulin 1, thaumatin-like protein (TL1), small hydroph479008320 (13)gb:AY422690_16053523e-37Nicotiana attenuata tissue-type shoot beta-tubulin (TUB) mRNA, complete cds.
JMFF051L02Sequence623000189 (25)gb:AF049870_17641023e-81Arabidopsis thaliana beta tubulin 1, thaumatin-like protein (TL1), small hydroph450008320 (13)gb:AP005192_18491707e-23Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P048
JMFN009D01Sequence506008320 (13)gb:AY422690_16053523e-43Nicotiana attenuata tissue-type shoot beta-tubulin (TUB) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF023L17+ TACCTGCTGCTTGAGNTTCCCCGGGCAGCTGA
                      ____________________________________________________________
consensus TACCTGCTGCTTGAGNTTCCCCGGGCAGCTGA
 
. : . : . : . : . : . :
rJMFF023L17+ ATTCAGATCTGCGGAAACTGGCTGTGAATTTGATTCCATT-CCCACGTCTTCATTTCTTC
rJMFF013G23+ ATTTGATTCCATTCCCCACGTCTTCATTTCTTC
                      ____________________________________________________________
consensus ATTCAGATCTGCGGAAACTGGCTGTGAATTTGATTCCATTCCCCACGTCTTCATTTCTTC
 
. : . : . : . : . : . :
rJMFF036D04+ GGTCACAGCAATACATCTCTCTCACAGT
rJMFF023L17+ ATGGTGGGATTTGCACCACTCACCTNCCCGTGGGTCACAGCAATACATCTCTCTCACAGT
rJMFF023E23+ CCGTGGGTCACAGCAATACATCTCTCTCACAGT
rJMFF013G23+ ATGGTGGGATTTGCACCACTCACCTTCCCGTGGGTCACAGCAATACATCTCTCTCACAGT
rJMFF034E11+ TGGGTCACAGCAATACATCTCTCTCACAGT
rJMFF029P04+ CCGTGGGTCACAGCAATACATCTCTCTCACAGT
rJMFF019F12+ AGT
rJMFF004E22+ ACAGT
                      ____________________________________________________________
consensus ATGGTGGGATTTGCACCACTCACCTTCCCGTGGGTCACAGCAATACATCTCTCTCACAGT
 
. : . : . : . : . : . :
rJMFF036D04+ CCCGGAACTTACTCAGCAAATGTGGGATGCCAAGAACAAGATGTGTGCAGCTGATCCTCG
rJMFF023L17+ CCCGGAACTTACTCAGCAAATGTGGGATGCCAAGAACAAGATGTGTGCAGCTGATCCTCG
rJMFF023E23+ CCCGGAACTTACTCAGCAAATGTGGGATGCCAAGAACATGATGTGTGCAGCTGATCCTCG
rJMFF013G23+ CCCGGAACTTACTCAGCAAATGTGGGATGCCAAGAACATGATGTGTGCAGCTGATCCTCG
rJMFF034E11+ CCCGGAACTTACTCAGCAAATGTGGGATGCCAAGAACATGATGTGTGCAGNTGATCCTCG
rJMFF029P04+ CCCGGAACTTACTCAGCAAATGTGGGATGCCAAGAACATGATGTGTGCAGCTGATCCTCG
rJMFF019F12+ CCCGGAACTTACTCAGCAAATGTGGGATGCCAAGAACATGATGTGTGCAGCTGATCCTCG
rJMFF045A06+ AAATGTGGGATGCCAAGAACATGATGTGTGCAGCTGATCCTCG
rJMFF004E22+ CCCGGAACTTACTCAGCAAATGTGGGATGCCAAGAACATGATGTGTGCAGCTGATCCTCG
                      ____________________________________________________________
consensus CCCGGAACTTACTCAGCAAATGTGGGATGCCAAGAACATGATGTGTGCAGCTGATCCTCG
 
. : . : . : . : . : . :
rJMFF036D04+ CCATGGACGCTACCTAACAGCCTCCGCCATGTTCAGAGGTAAAATGAGCACAAAAGAAGT
rJMFF023L17+ CCATGGACGCTACCTAACAGCCTCCGCCATGTTCAGAGGTAAAATGAGCACAAAAGAAGT
rJMFF023E23+ CCATGGACGCTACCTAACAGCCTCCGCCATGTTCAGAGGTAAAATGAGCACAAAAGAAGT
rJMFF013G23+ CCATGGACGCTACCTAACAGCCTCCGCCATGTTCAGAGGTAAAATGAGCACAAAAGAAGT
rJMFF034E11+ CCATGGACGCTACCTAACAGCCTCCGCCATGTTCAGAGGTAAAATGAGCACAAAAGAAGT
rJMFF029P04+ CCATGGACGCTACCTAACAGCCTCCGCCATGTTCAGAGGTAAAATGAGCACAAAAGAAGT
rJMFF019F12+ CCATGGACGCTACCTAACAGCCTCCGCCATGTTCAGAGGTAAAATGAGCACAAAAGAAGT
rJMFF045A06+ CCATGGACGCTACCTAACAGCCTCCGCCATGTTCAGAGGTAAAATGAGCACAAAAGAAGT
rJMFF004E22+ CCATGGACGCTACCTAACAGCCTCCGCCATGTTCAGAGGTAAAATGAGCACAAAAGAAGT
                      ____________________________________________________________
consensus CCATGGACGCTACCTAACAGCCTCCGCCATGTTCAGAGGTAAAATGAGCACAAAAGAAGT
 
. : . : . : . : . : . :
rJMFF036D04+ AGATGAACAGATGATCAATGTGCAGAACAAGAACTCGTCCTATTTCGTGGAGTGGATCCC
rJMFF023L17+ AGATGAACAGATGATCAATGTGCAGAACAAGAACTCGTCCTATTTCGTGGAGTGGATCCC
rJMFF023E23+ AGATGAACAGATGATCAATGTGCAGAACAAGAACTCGTCCTATTTCGTGGAGTGGATCCC
rJMFF013G23+ AGATGAACAGATGATCAATGTGCAGAACAAGAACTCGTCCTATTTCGTGGAGTGGATCCC
rJMFF034E11+ AGATGAACAGATGATCAATGTGCAGAACAAGAACTCGTCCTATTTCGTGGAGTGGATCCC
rJMFF029P04+ AGATGAACAGATGATCAATGTGCAGAACAAGAACTCGTCCTATTTCGTGGAGTGGATCCC
rJMFF019F12+ AGATGAACAGATGATCAATGTGCAGAACAAGAACTCGTCCTATTTCGTGGAGTGGATCCC
rJMFF045A06+ AGATGAACAGATGATCAATGTGCAGAACAAGAACTCGTCCTATTTCGTGGAGTGGATCCC
rJMFF046F07+ ATCCC
rJMFF008J07+ GTGGAGTGGATCCN
JMFN009D01- AAGAACTCGTCCTATTTCGTGGAGTGGATCCC
rJMFF004E22+ AGATGAACAGATGATCAATGTGCAGAACAAGAACTCGTCCTATTTCGTGGAGTGGATCCC
                      ____________________________________________________________
consensus AGATGAACAGATGATCAATGTGCAGAACAAGAACTCGTCCTATTTCGTGGAGTGGATCCC
 
. : . : . : . : . : . :
rJMFF036D04+ TAACAACGTGAAGTCAAGCGTGTGTGATATACCACCAACCGGCCTCAAGATGGCATCAAC
rJMFF023L17+ TAACAACGTGAAGTCAAGCGTGTGTGATATACCACCAACCGGCCTCAAGATGGCATCAAC
rJMFF023E23+ TAACAACGTGAAGTCAAGCGTGTGTGATATACCACCAACCGGCCTCAAGATGGCATCAAC
rJMFF013G23+ TAACAACGTGAAGTCAAGCGTGTGTGATATACCACCAACCGGCCTCAAGATGGCATCAAC
rJMFF034E11+ TAACAACGTGAAGTCAAGCGTGTGTGATATACCACCAACCGGCCTCAAGATGGCATCAAC
rJMFF029P04+ TAACAACGTGAAGTCAAGCGTGTGTGATATACCACCAACCGGCCTCAAGATGGCATCAAC
rJMFF019F12+ TAACAACGTGAAGTCAAGCGTGTGTGATATACCACCAACCGGCCTCAAGATGGCATCAAC
rJMFF045A06+ TAACAACGTGAAGTCAAGCGTGTGTGATATACCACCAACCGGCCTCAAGATGGCATCAAC
rJMFF046F07+ TAACAACGTGAAGTCAAGCGTGTGTGATATACCACCAACCGGCCTCAAGATGGCATCAAC
rJMFF008J07+ TAACAACGTGAAGTCAAGCGTGTGTGATATACCACCAACCGGCCTCANGATGGCATCNAC
JMFN009D01- TAACAACGTGAAGTCAAGCGTGTGTGATATACCACCAACCGGCCTCAAGATGGCATCAAC
rJMFF004E22+ TAACAACGTGAAGTCAAGCGTGTGTGATATACCACCAACCGGCCTCAAGATGGCATCAAC
                      ____________________________________________________________
consensus TAACAACGTGAAGTCAAGCGTGTGTGATATACCACCAACCGGCCTCAAGATGGCATCAAC
 
. : . : . : . : . : . :
rJMFF036D04+ ATTCGTTGGGAATTCAACATCAATTCAAGAGATGTTTAGGCGAGTAAGCGAGCAGTTTAC
rJMFF023L17+ ATTCGTTGGGAATTCAACATCAATTCAAGAGATGTTTAGGCGAGTAAGCGAGCAGTTTAC
rJMFF023E23+ ATTCGTTGGGAATTCAACATCAATTCAAGAGATGTTTAGGCGAGTAAGCGAGCAGTTTAC
rJMFF013G23+ ATTCGTTGGGAATTCAACATCAATTCAAGAGATGTTTAGGCGAGTAAGCGAGCAGTTTAC
rJMFF034E11+ ATTCGTTGGGAATTCAACATCAATTCAAGAGATGTTTAGGCGAGTAAGCGAGCAGTTTAC
rJMFF029P04+ ATTCGTTGGGAATTCAACATCAATTCAAGAGATGTTTAGGCGAGTAAGCGAGCAGTTTAC
rJMFF019F12+ ATTCGTTGGGAATTCAACATCAATTCAAGAGATGTTTAGGCGAGTAAGCGAGCAGTTTAC
rJMFF045A06+ ATTCGTTGGGAATTCAACATCAATTCAAGAGATGTTTAGGCGAGTAAGCGAGCAGTTTAC
rJMFF046F07+ ATTCGTTGGGAATTCAACATCAATTCAAGAGATGTTTAGGCGAGTAAGCGAGCAGTTTAC
rJMFF008J07+ ATTNGTTGGGAATTCAACATCAATTCAAGAGATGTTTAGGCGAGTAAGCGAGCAGTNTAC
JMFN009D01- ATTCGTTGGGAATTCAACATCAATTCAAGAGATGTTTAGGCGAGTAAGCGAGCAGTTTAC
rJMFF051L02+ GGGAATTCAACATCAATTCAAGAGATGTTTAGGCGAGTAAGCGAGCAGTTTAC
rJMFF004E22+ ATTCGTTGGGAATTCAACATCAATTCAAGAGATGTTTAGGCGAGTAAGCGAGCAGTTTAC
                      ____________________________________________________________
consensus ATTCGTTGGGAATTCAACATCAATTCAAGAGATGTTTAGGCGAGTAAGCGAGCAGTTTAC
 
. : . : . : . : . : . :
rJMFF036D04+ AGCCATGTTTAGGCGCAAGGCCTTCTTGCATTGGTACACAGGGGAAGGGATGGATGAGAT
rJMFF023L17+ AGCCATGTTTAGGCGCAAGGCCTTCTTGCATTGGTACACAGGGGAAGGGATGGATGAGAT
rJMFF023E23+ AGCCATGTTTAGGCGCAAGGCCTTCTTGCATTGGTACACAGGGGAAGGGATGGATGAGAT
rJMFF013G23+ AGCCATGTTTAGGCGCAAGGCCTTCTTGCATTGGTACACAGGGGAAGGGATGGATGAGAT
rJMFF034E11+ AGCCATGTTTAGGCGCAAGGCCTTCTTGCATTGGTACACAGGGGAAGGGATGGATGAGAT
rJMFF029P04+ AGCCATGTTTAGGCGCAAGGCCTTCTTGCATTGGTACACAGGGGAAGGGATGGATGAGAT
rJMFF019F12+ AGCCATGTTTAGGCGCAAGGCCTTCTTGCATTGGTACACAGGGGAAGGGATGGATGAGAT
rJMFF045A06+ AGCCATGTTTAGGCGCAAGGCCTTCTTGCATTGGTACACAGGGGAAGGGATGGATGAGAT
rJMFF046F07+ AGCCATGTTTAGGCGCAAGGCCTTCTTGCATTGGTACACAGGGGAAGGGATGGATGAGAT
rJMFF008J07+ AGCCATGTTTAGGCGCAAGGCCTTCTTGCATTGGTACACAGGGGAAGGGATGGATGAGAT
JMFN009D01- AGCCATGTTTAGGCGCAAGGCCTTCTTGCATTGGTACACAGGGGAAGGGATGGATGAGAT
rJMFF051L02+ AGCCATGTTTAGGCGCAAGGCCTTCTTGCATTGGTACACAGGGGAAGGGATGGATGAGAT
rJMFF004E22+ AGCCATGTTTAGGCGCAAGGCCTTCTTGCATTGGTACACAGGGGAAGGGATGGATGAGAT
                      ____________________________________________________________
consensus AGCCATGTTTAGGCGCAAGGCCTTCTTGCATTGGTACACAGGGGAAGGGATGGATGAGAT
 
. : . : . : . : . : . :
rJMFF036D04+ GGAGTTCACCGAAGCTGAGAGCAATATGAATGATTTAGTGGCAGAGTACCAACAATACCA
rJMFF023L17+ GGAGTTCACCGAAGCTGAGAGCAATATGAATGATTTAGTGGCAGAGTACCAACAATACCA
rJMFF023E23+ GGAGTTCACCGAAGCTGAGAGCAATATGAATGATTTAGTGGCAGAGTACCAACAATACCA
rJMFF013G23+ GGAGTTCACCGAAGCTGAGAGCAATATGAATGATTTAGTGGCAGAGTACCAACAATACCA
rJMFF034E11+ GGAGTTCACCGAAGCTGAGAGCAATATGAATGATTTAGTGGCAGAGTACCAACAATACCA
rJMFF029P04+ GGAGTTCACCGAAGCTGAGAGCAATATGAATGATTTAGTGGCAGAGTACCAACAATACCA
rJMFF019F12+ GGAGTTCACCGAAGCTGAGAGCAATATGAATGATTTAGTGGCAGAGTACCAACAATACCA
rJMFF045A06+ GGAGTTCACCGAAGCTGAGAGCAATATGAATGATTTAGTGGCAGAGTACCAACAATACCA
rJMFF046F07+ GGAGTTCACCGAAGCTGAGAGCAATATGAATGATTTAGTGGCAGAGTACCAACAATACCA
rJMFF008J07+ GGAGTTCACCGAAGCTGAGAGCAATATGAATGATTTAGTGGCAGAGTA
JMFN009D01- GGAGTTCACCGAAGCTGAGAGCAATATGAATGATTTAGTGGCAGAGTACCAACAATACCA
rJMFF051L02+ GGAGTTCACCGAAGCTGAGAGCAATATGAATGATTTAGTGGCAGAGTACCAACAATACCA
rJMFF004E22+ GGAGTTCACCGAAGCTGAGAGCAATATGAATGATTTAGTGGCAGAGTACCAACAATACCA
                      ____________________________________________________________
consensus GGAGTTCACCGAAGCTGAGAGCAATATGAATGATTTAGTGGCAGAGTACCAACAATACCA
 
. : . : . : . : . : . :
rJMFF036D04+ AGATGCCACTGCAGACGACGAAGAAGAATATGAAGGAGAGGTTGGTGATCAGGAGTTCGA
rJMFF023L17+ AGATGCCACTGCAGACGACGAAGAAGAATATGAAGGAGAGGTTGGTGATCAGGAGTTCGA
rJMFF023E23+ AGATGCCACTGCAGACGACGAAGAAGAATATGAAGGAGAGGTTGGTGATCAGGAGTTCGA
rJMFF013G23+ AGATGCCACTGCAGACGACGAAGAAGAATATGAAGGAGAGGTTGGTGATCAGGAGTTCGA
rJMFF034E11+ AGATGCCACTGCAGACGACGAAGAAGAATATGAAGGAGAGGTTGGTGATCAGGAGTTCGA
rJMFF029P04+ AGATGCCACTGCAGACGACGAAGAAGAATATGAAGGAGAGGTTGGTGATCAGGAGTTCGA
rJMFF019F12+ AGATGCCACTGCAGACGACGAAGAAGAATATGAAGGAGAGGTTGGTGATCAGGAGTTCGA
rJMFF045A06+ AGATGCCACTGCAGACGACGAAGAAGAATATGAAGGAGAGGTTGGTGATCAGGAGTTCGA
rJMFF046F07+ AGATGCCACTGCAGACGACGAAGAAGAATATGAAGGAGAGGTTGGTGATCAGGAGTTCGA
JMFN009D01- AGATGCCACTGCAGACGACGAAGAAGAATATGAAGGAGAGGTTGGTGATCAGGAGTTCGA
rJMFF051L02+ AGATGCCACTGCAGACGACGAAGAAGAATATGAAGGAGAGGTTGGTGATCAGGAGTTCGA
rJMFF004E22+ AGATGCCACTGCAGACGACGAAGAAGAATATGAAGGAGAGGTTGGTGATCAGGAGTTCGA
                      ____________________________________________________________
consensus AGATGCCACTGCAGACGACGAAGAAGAATATGAAGGAGAGGTTGGTGATCAGGAGTTCGA
 
. : . : . : . : . : . :
rJMFF036D04+ GTGATGGCTAAGTAATGCAAACTCAGACCTGTTGTTATGTTGTTTTTATCATCTTATGCA
rJMFF023L17+ GTGATGGCTAAGTAATGCAAACTCAGACCTGTTGTTATGTTGTTTTTATCATCTTATGCA
rJMFF023E23+ GTGATGGCTAAGTAATGCAAACTCAGACCTGTTGTTATGTTGTTTTTATCATCTTATGCA
rJMFF013G23+ GTGATGGCTAAGTAATGCAAACTCAGACCTGTTGTTATGTTGTTTTTATCATCTTATGCA
rJMFF034E11+ GTGATGGCTAAGTAATGCAAACTCAGACCTGTTGTTATGTTGTTTTTATCATCTTATGCA
rJMFF029P04+ GTGATGGCTAAGTAATGCAAACTCAGACCTGTTGTTATGTTG---TTATCATCTTATGCA
rJMFF019F12+ GTGATGGCTAAGTAATGCAAACTCAGACCTGTTGTTATGTTGTTTTTATCATCTTATGCA
rJMFF045A06+ GTGATGGCTAAGTAATGCAAACTCAGACCTGTTGTTATGTTGTTTTTATCATCTTATGCA
rJMFF046F07+ GTGATGGCTAAGTAATGCAAACTCAGACCTGTTGTTATGTTGTTTTTATCATCTTATGCA
JMFN009D01- GTGATGGCTAAGTAATGCAAACTCAGACCTGTTGTTATGTTGTTTTTATCATCTTATGCA
rJMFF051L02+ GTGATGGCTAAGTAATGCAAACTCAGACCTGTTGTTATGTTGTTTTTATCATCTTATGCA
rJMFF004E22+ GTGATGGCTAAGTAATGCAAACTCAGACCTGTTGTTATGTTGTTTTTATCATCTTATGCA
                      ____________________________________________________________
consensus GTGATGGCTAAGTAATGCAAACTCAGACCTGTTGTTATGTTGTTTTTATCATCTTATGCA
 
. : . : . : . : . : . :
rJMFF036D04+ AAGTGAATGCTCTGCTGTTTCTTCCTTGTTAAAATTCATTTTCATTATTCTGAACTCGCA
rJMFF023L17+ AAGTGAATGCTCTGCTGTTTCTTCCTTGTTAAAATTCATTTTCATTATTCTGAACTCGCA
rJMFF023E23+ AAGTGAATGCTCTGCTGTTTCTTCCTTGTTAAAATTCATTTTCATTATTCTGAACTCGCA
rJMFF013G23+ AAGTGAATGCTCTGCTGTTTCTTCCTTGTTAAAATTCATTTTCATTATTCTGAACTCGCA
rJMFF034E11+ AAGTGAATGCTCTGCTGTTTCTTCCTTGTTAAAATTCATTTTCATTATTCTGAACTCGCA
rJMFF029P04+ AAGTGAATGCTCTGCTGTTTCTTCCTTGTTAAAATTCATTTTCATTATTCTGAACTCGCA
rJMFF019F12+ AAGTGAATGCTCTGCTGTTTCTTCCTTGTTAAAATTCATTTTCATTATTCTGAACTCGCA
rJMFF045A06+ AAGTGAATGCTCTGCTGTTTCTTCCTTGTTAAAATTCATTTTCATTATTCTGAACTCGCA
rJMFF046F07+ AAGTGAATGCTCTGCTGTTTCTTCCTTGTTAAAATTCATTTTCATTATTCTGAACTCGCA
JMFN009D01- AAGTGAATGCTCTGCTGTTTCTTCCTTGTTAAAATTCATTTTCATTATTCTGAACTCGCA
rJMFF051L02+ AAGTGAATGCTCTGCTGTTTCTTCCTTGTTAAAATTCATTTTCATTATTCTGAACTCGCA
rJMFF004E22+ AAGTGAATGCTCTGCTGTTTCTTCCTTGTTAAAATTCATTTTCATTATTCTGAACTCGCA
                      ____________________________________________________________
consensus AAGTGAATGCTCTGCTGTTTCTTCCTTGTTAAAATTCATTTTCATTATTCTGAACTCGCA
 
. : . : . : . : . : . :
rJMFF036D04+ TGCATATTTGTTTGTTAAATA-TTGAGCG-TNGAATAAG
rJMFF023L17+ TGCATATTTGTTTGTTAAATA-TTGAGCG-TGGAATAAGA
rJMFF023E23+ TGCATATTTGTTTGTTAAATATTTGAGCGT
rJMFF013G23+ TGCATATTTGTTTGTTAAATA-TTGAGCG-TNGAATAAGA
rJMFF034E11+ TGCATATTTGTTTGTTAAATA-TTGAGCG-TGGAATAAGA
rJMFF029P04+ TGCATATTTGTTTGTTAAATATTTGAGCG-TGGAATAAGAGT
rJMFF019F12+ TGCATATTTGTTTGTTAAATATTTGAGCGTTGGAATAAGAGTGTACTCCGTATTATATTG
rJMFF045A06+ TGCATATTTGTTTGTTAAATATTTGAGCGTTGGAATAA
rJMFF046F07+ TGCATATTTGTTTGTTAAATATTTGAGCGTTGGAATAAGAGTGTACTCCGTATT
JMFN009D01- TGCATATTTGTTTGTTAAATATTTGAGCGTTGGAATAAGAGTGTACTCCGTATT
rJMFF051L02+ TGCATATTTGTTTGTTAAATATTTGAGCGTTGGAATAAGAGTGTACTCCGTATTATATTG
rJMFF004E22+ TGCATATTTGTTTGTTAAATATTTGAGCGTTGGAATAAGAGTGTACTCCGTATTATATTG
                      ____________________________________________________________
consensus TGCATATTTGTTTGTTAAATATTTGAGCGTTGGAATAAGAGTGTACTCCGTATTATATTG
 
. : . : . : . : . : . :
rJMFF019F12+ CACTAGTTTATTTTTAATGAGTTAATTTTATCTCAAATGCAACCTTCA
rJMFF051L02+ CA
rJMFF004E22+ CACTAGTTTATTTTTAATGAGTTAATTTTATCTCAAATGCAACCTTCAATGCAATATATA
                      ____________________________________________________________
consensus CACTAGTTTATTTTTAATGAGTTAATTTTATCTCAAATGCAACCTTCAATGCAATATATA