Previous Contig 008317:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004E04Sequence473005266 (11)gb:AF083691_17669225e-33Arabidopsis thaliana clone sps142 unknown mRNA.379008317 (15)
JMFF006C07Sequence452005266 (11)gb:AF083691_17669222e-29Arabidopsis thaliana clone sps142 unknown mRNA.287008317 (15)
JMFF017E02Sequence504005266 (11)gb:AF083691_17669222e-38Arabidopsis thaliana clone sps142 unknown mRNA.162008317 (15)
JMFF020L18Sequence356005266 (11)gb:AF083691_17669223e-28Arabidopsis thaliana clone sps142 unknown mRNA.201008317 (15)pir|A84889|A848896e-15probable nucleotide sugar epimerase [imported] - Arabidopsis thaliana>gb:AC00238
JMFF030G24Sequence551008317 (15)gb:AF083691_17669222e-60Arabidopsis thaliana clone sps142 unknown mRNA.128008317 (15)
JMFF030P17Sequence506005266 (11)gb:AF083691_17669222e-38Arabidopsis thaliana clone sps142 unknown mRNA.261008317 (15)
JMFF051D21Sequence597002193 (6)gb:AF083691_17669223e-48Arabidopsis thaliana clone sps142 unknown mRNA.467008317 (15)gb:AF083691_17669224e-41Arabidopsis thaliana clone sps142 unknown mRNA.
JMFN015C05Sequence515008317 (15)gb:AF083691_17669225e-40Arabidopsis thaliana clone sps142 unknown mRNA.
JMFN031M24Sequence559008317 (15)gb:AF083691_17669221e-29Arabidopsis thaliana clone sps142 unknown mRNA.
JMFN034B23Sequence624008317 (15)gb:AF083691_17669225e-29Arabidopsis thaliana clone sps142 unknown mRNA.
JMFN042G18Sequence561008317 (15)gb:AF083691_17669222e-56Arabidopsis thaliana clone sps142 unknown mRNA.
JMSF011L22Sequence273005266 (11)gb:AF083691_17669228e-11Arabidopsis thaliana clone sps142 unknown mRNA.260008317 (15)
JMSF040E07Sequence720005266 (11)gb:AF083691_17669226e-75Arabidopsis thaliana clone sps142 unknown mRNA.778008317 (15)gb:AF083691_17669229e-70Arabidopsis thaliana clone sps142 unknown mRNA.
JMSF047P10Sequence116005266 (11)gb:AF083691_17669224e-12Arabidopsis thaliana clone sps142 unknown mRNA.155008317 (15)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040E07+ TAAAGTCCCGTTTT
                      ____________________________________________________________
consensus TAAAGTCCCGTTTT
 
. : . : . : . : . : . :
rJMSF040E07+ NGGAAAACCNCCGCACCGATCAACCCGCCNGCCTTTACGCCGNCACCAAAAAAGCCGGCG
                      ____________________________________________________________
consensus NGGAAAACCNCCGCACCGATCAACCCGCCNGCCTTTACGCCGNCACCAAAAAAGCCGGCG
 
. : . : . : . : . : . :
rJMSF040E07+ AGGAAATCGCGCACNNTTNTAACCACATTTTCGGCCTNTCCCTAACCGGGNTGNGATTTT
                      ____________________________________________________________
consensus AGGAAATCGCGCACNNTTNTAACCACATTTTCGGCCTNTCCCTAACCGGGNTGNGATTTT
 
. : . : . : . : . : . :
rJMSF040E07+ TCNCCGTTTNCGGGCCCTGGGGCCGGCCCGACNTGGGGTNTTTTTTTTTCNCCAAGGNCN
                      ____________________________________________________________
consensus TCNCCGTTTNCGGGCCCTGGGGCCGGCCCGACNTGGGGTNTTTTTTTTTCNCCAAGGNCN
 
. : . : . : . : . : . :
JMFN042G18- TGCTCCAGGGGAAGCCGATCAACGTGTACGTCACGCAGGAGGACAAGGAGGTGGCGCGTG
JMFF030G24- TGCTCCAGGGGAAGCCGATCAACGTGTACGTCACGCAGGAGGACAAGGAGGTGGCGCGTG
rJMSF040E07+ TGCTCCNGGGGAAGCCGATNAACGTNTNCGTCNCGCAGGAGGACAAGGAGGTGGCGCGTG
                      ____________________________________________________________
consensus TGCTCCAGGGGAAGCCGATCAACGTGTACGTCACGCAGGAGGACAAGGAGGTGGCGCGTG
 
. : . : . : . : . : . :
JMFN042G18- ACTTCACGTACATCGACGACGTCGTGAAGGGGTGCGTGGGGGCGCTGGACACGGCGGAGA
rJMFF020L18+ CGTGGGGGCNCTNGACCCNGCGGAGA
JMFF030G24- ACTTCACGTACATCGACGACGTCGTGAAGGGGTGCGTGGGGGCGCTGGACACGGCGGAGA
rJMSF040E07+ ACTTCACGTACATTGACGACGTNGTGAAGGGGTGCGTGGGGGCGCTGGACNCGGCGGAGA
JMFN015C05- GGCGCTGGACACGGCGGAGA
                      ____________________________________________________________
consensus ACTTCACGTACATCGACGACGTCGTGAAGGGGTGCGTGGGGGCGCTGGACACGGCGGAGA
 
. : . : . : . : . : . :
JMFN042G18- AGAGCACCGGCAGCGGCGGGAAGAAGAAAGGGCCGGCGCAGTTGAGGGTGTACAACCTGG
rJMFF051D21+ AAGAAGAAGGGGCCGGCGCAGTTGAGGGTGTACAACCTGG
rJMFF020L18+ AGAGCCCCGGCANCGGNGGGAANAANAAAGGGCCGGCNCANTTGAGGGTGTNCAACCTGG
JMFF030G24- AGAGCACCGGCAGCGGCGGGAAGAAGAAAGGGCCGGCGCAGTTGAGGGTGTACAACCTGG
rJMSF040E07+ AGAGCNCCGGCAGCGGCGGGAAGAAGAAAGGGCCGGCGCAGTTGAGGGTGTNCAACCTGG
JMFN015C05- AGAGCACCGGCAGCGGCGGGAAGAAGAAAGGGCCGGCGCAGTTGAGGGTGTACAACCTGG
                      ____________________________________________________________
consensus AGAGCACCGGCAGCGGCGGGAAGAAGAAAGGGCCGGCGCAGTTGAGGGTGTACAACCTGG
 
. : . : . : . : . : . :
JMFN042G18- GGAACACGTCGCCGGTGTCGGTGAGGAAGCTGGTGTCGATTCTTGAAAATCTGTTGAGCA
rJMFF051D21+ GTAACACGTCGCCAGTGTCGGTGAGGAAGCTAGTGGCAATTCTAGAAAATTTGCTCAACA
rJMFF020L18+ GGAACNCGTNGCCGGTGTNGGTGAGGAANCTGGTGTTGATTTTTGAAAATTTGTTGANCA
JMFF030G24- GGAACACGTCGCCGGTGTCGGTGAGGAAGCTGGTGTCGATTCTTGAAAATCTGTTGAGCA
rJMSF040E07+ GGAACACGTNGCCGGNGTCGGTGAGGAAGCTGGTGTCGATTCTTGAAAATNTGTTGAGCA
JMFN015C05- GGAACACGTCGCCGGTGTCGGTGAGGAAGCTGGTGTCGATTCTTGAAAATCTGTTGAGCA
JMFN031M24- TCGGTGAGGAAGCTGGTGTCGATTCTTGAAAATCTGTTGAGCA
JMFN034B23- CTGGTGTCGATTCTTGAAAATCTGTTGAGCA
                      ____________________________________________________________
consensus GGAACACGTCGCCGGTGTCGGTGAGGAAGCTGGTGTCGATTCTTGAAAATCTGTTGAGCA
 
. : . : . : . : . : . :
JMFN042G18- TCAAGGCTAAAAAGAACGTGGTCAAGATGCCCCGAAACGGCGACGTTCCGTTCACCCATG
rJMFF051D21+ TCAAGGCTAAAAAGAACGTTGTAAAGATGCCCCGAAACGGCGACGTTCCGTACACCCACG
rJMFF020L18+ TCAAGGGTAAAAAGAACGTGGTCAAGATNCCCCGAAACGGNGACGTTCCGTT
JMFF030G24- TCAAGGCTAAAAAGAACGTGGTCAAGATGCCCCGAAACGGCGACGTTCCGTTCACCCATG
rJMSF040E07+ TCAAGGNTAAAAAGAACGTGGTCAAGATGCCCCGAAACGGNGACGTTCCGTTCNCCCNTG
JMFN015C05- TCAAGGCTAAAAAGAACGTGGTCAAGATGCCCCGAAACGGCGACGTTCCGTTCACCCATG
JMFN031M24- TCAAGGCTAAAAAGAACGTGGTCAAGATGCCCCGAAACGGCGACGTTCCGTTCACCCATG
JMFN034B23- TCAAGGCTAAAAAGAACGTGGTCAAGATGCCCCGAAACGGCGACGTTCCGTTCACCCATG
                      ____________________________________________________________
consensus TCAAGGCTAAAAAGAACGTGGTCAAGATGCCCCGAAACGGCGACGTTCCGTTCACCCATG
 
. : . : . : . : . : . :
JMFN042G18- CTAACGTGAGCCTGGCGTACAAGGACTTCGGGTACAAACCCACCACGGATCTTTCATCCG
rJMFF051D21+ CTAACGTGAGCCTTGCCTACAGGGACTTCGGCTACAAACCAACCACGGACTTGTCAAGTG
JMFF030G24- CTAACGTGAGCCTGGCGTACAAGGACTTCGGGTACAAACCCACCACGGATCTTTCATCCG
rJMSF040E07+ CTAACGTGAGCCTGGNGTACAAGGACTTNGGGTACAAACCCCCCNCGGATNTTTCATCCG
JMFN015C05- CTAACGTGAGCCTGGCGTACAAGGACTTCGGGTACAAACCCACCACGGATCTTTCATCCG
JMFN031M24- CTAACGTGAGCCTGGCGTACAAGGACTTCGGGTACAAACCCACCACGGATCTTTCATCCG
JMFN034B23- CTAACGTGAGCCTGGCGTACAAGGACTTCGGGTACAAACCCACCACGGATCTTTCATCCG
                      ____________________________________________________________
consensus CTAACGTGAGCCTGGCGTACAAGGACTTCGGGTACAAACCCACCACGGATCTTTCATCCG
 
. : . : . : . : . : . :
JMFN042G18- GGTTAAGAAAATTCGTCAAGTGGTACGTTAGTTATTACGGGATACAATCAAGGGTAAAAA
rJMFF051D21+ GATTGAGAAAGTTCGTCAAGTGGTACGTTAGTTATTACGGTATTCAATCAAGGGTAAAAA
JMFF030G24- GGTTAAGAAAATTCGTCAAGTGGTACGTTAGTTATTACGGGATACAATCAAGGGTAAAAA
rJMSF040E07+ GGTTAAGAAAATTNGTCAAGTGGTACGTTAGTTNTTNCGGGATNCAATCAAGGGTAAAAA
JMFN015C05- GGTTAAGAAAATTCGTCAAGTGGTACGTTAGTTATTACGGGATACAATCAAGGGTAAAAA
JMFN031M24- GGTTAAGAAAATTCGTCAAGTGGTACGTTAGTTATTACGGGATACAATCAAGGGTAAAAA
JMFN034B23- GGTTAAGAAAATTCGTCAAGTGGTACGTTAGTTATTACGGGATACAATCAAGGGTAAAAA
                      ____________________________________________________________
consensus GGTTAAGAAAATTCGTCAAGTGGTACGTTAGTTATTACGGGATACAATCAAGGGTAAAAA
 
. : . : . : . : . : . :
JMFN042G18- CGGAATTACACCCTACCCATCAGTCCGATGATTAAGCTGTGGGGCCCAACAACAAGCGGT
rJMFF051D21+ AGGAATTA
JMFF030G24- CGGAATTACACCCTACCCATCAGTCCGATGATTAAGCTGTGGGGCCCAACAACAAGCGGT
rJMSF040E07+ CGGAATTACCCCCTNCCCNTCAGTCCGATGATTAAGCTGNGGGGCCCAACAACAAGCGGN
JMFN015C05- CGGAATTACACCCTACCCATCAGTCCGATGATTAAGCTGTGGGGCCCAACAACAAGCGGT
JMFN031M24- CGGAATTACACCCTACCCATCAGTCCGATGATTAAGCTGTGGGGCCCAACAACAAGCGGT
JMFN034B23- CGGAATTACACCCTACCCATCAGTCCGATGATTAAGCTGTGGGGCCCAACAACAAGCGGT
                      ____________________________________________________________
consensus CGGAATTACACCCTACCCATCAGTCCGATGATTAAGCTGTGGGGCCCAACAACAAGCGGT
 
. : . : . : . : . : . :
JMFN042G18- GCTGCCTTTCTGGCTTTCTTTCCTTTTTTTTTTTTATAACTTATTTTTCCCA-CTCAAAT
JMFF030G24- GCTGCCTTTCTGGCTTTCTTTCC--TTTTTTTTTTATAACTTATTTTTCCC
rJMSF040E07+ GCTGCCTTTCTGGCTTTNTTTCCTTTTTTTTTTTTATAACTTATTTTTCCCATCTCAAAT
JMFN015C05- GCTGCCTTTCTGGCTTTCTTTCC-TTTTTTTTTTTATAACTTATTTTTCCCA-CTCAAAT
rJMFF030P17+ TTTTTTTTTTTATAACTTATTTTTCCCC-CTCAAAT
rJMFF006C07+ TTTTTTTTTTTANAACTTATTTTTCCCC-CTCAAAT
JMFN031M24- GCTGCCTTTCTGGCTTTCTTTCCTTTTTTTTTTTTATAACTTATTTTTCCCA-CTCAAAT
rJMSF011L22+ TTTTTTTTTTATAACTTATTTTTCCCC-CTCAAAT
rJMFF017E02+ TATTTTTCCCC-CTCAAAN
JMFN034B23- GCTGCCTTTCTGGCTTTCTTTCCTTTTTTTTTTTTATAACTTATTTTTCCCA-CTCAAAT
rJMFF004E04+ TTTTTTTTTTTANAANTTATTTTTNCCN-CTCAAAT
                      ____________________________________________________________
consensus GCTGCCTTTCTGGCTTTCTTTCCTTTTTTTTTTTTATAACTTATTTTTCCCA-CTCAAAT
 
. : . : . : . : . : . :
JMFN042G18- ATAATATATTTAT
rJMSF040E07+ ATAATATATTTATTTAAAATTACCTGTTCCATGTATTTTGAATC
JMFN015C05- ATAATATATTTATTTAAAATTA-CTGTT-CATGTATTTTGAATCTTATAGGGATAGATAG
rJMFF030P17+ ATAATATNTTTATTTAAAATTA-CTGTT-CATGTNTTTTGAATTTTNTAGGGATAGATNG
rJMFF006C07+ NTAATNTNTTTNTTTAAAATTN-CTGTT-CANGTNTTTTGAATTTTNTNGGGATNGATNG
JMFN031M24- ATAATATATTTATTTAAAATTA-CTGTT-CATGTATTTTGAATCTTATAGGGATAGATGG
rJMSF011L22+ NTAATATATTTNTTTAAAATTN-CNGTT-CNTGTATTTTGAATNTTATAGGGNTAGNTAG
rJMFF017E02+ ATNATATATTTATTTAAAATTN-CTGTT-CANGTATTTTGAATTTTATAGGGATAGATAG
rJMFF030G24+ GGATAGATAG
JMFN034B23- ATAATATATTTATTTAAAATTA-CTGTT-CATGTATTTTGAATCTTATAGGGATAGATAG
rJMFF004E04+ NTAATATNTTTATTTAAAATTN-CTGTT-CANGTATTTTGAATTTTATAGGGATAGATAG
                      ____________________________________________________________
consensus ATAATATATTTATTTAAAATTA-CTGTT-CATGTATTTTGAATCTTATAGGGATAGATAG
 
. : . : . : . : . : . :
JMFN015C05- AATTTTATGTACAAAAAGT
rJMFF030P17+ AATTTTATGTCCAAAAAGTAAAAAAAAAAAATGGCATATCATATAAAGTAAGAAATATGA
rJMFF006C07+ AATTTTNTGTTCAAAAAGTNAAAAAAAAAAATGGCATATCATATAAAGTAAGAAATATGA
rJMSF047P10+ AAAAAAAAAAATGGCATATCATATAAAGTAAGAAATATGA
JMFN031M24- AATTTTATGTACAAAAAGTAAAAAAAAAAAATGGCATATCATATAAAGTAAGAAATATGA
rJMSF011L22+ AATTTTNTGTNCNAAAAGTAAAAAAAAAAAATGGCATATCATATAAAGTAAGAAATATGA
rJMFF017E02+ AATTTTATGTNCAAAAAGTAAAAAAAAAAAATGGCATATCATATAAAGTAAGAAATATGA
rJMFF030G24+ AATTTTATGTNCAAAAAGTAAAAAAAAAAAATGGCATATCATATAAAGTAAGAAATATGA
JMFN034B23- AATTTTATGTACAAAAAGTAAAAAAAAAAAATGGCATATCATATAAAGTAAGAAATATGA
rJMFF004E04+ AATTTTATGTNCAAAAAGTAAAAAAAAAAAATGGCATATCATATAAAGTAAGAAATATGA
                      ____________________________________________________________
consensus AATTTTATGTACAAAAAGTAAAAAAAAAAAATGGCATATCATATAAAGTAAGAAATATGA
 
. : . : . : . : . : . :
rJMFF030P17+ GAAGGAAAGGGGGA-GCAAGTGTAGATTTGAAAAGTGGAGTGGCAAATAANGTGAAAACA
rJMFF006C07+ GAAGGAAAGGGGGA-GCAAGTGTAGATTTGAAAAGTGGAGTGGCAAATAATGTGAAAACA
rJMSF047P10+ GAAGGAAAGGGGGATGCAANTGTAGATTTGAAAAGTGGAGTGGCAAATAATGTGAAAACA
JMFN031M24- GAAGGAAAGGGGGA-GCAAGTGTAGATTTGAAAAGTGGAGTGGCAAATAATGTGAAAACA
rJMSF011L22+ GAAGGAAAGGGGGA-GCAAGTGTAGATTTGAAAAGTGGAGTGGCAAATAATGTGAAAACA
rJMFF017E02+ GAAGGAAAGGGGCA-GCAAGTGTAGAT
rJMFF030G24+ GAAGGAAAGGGGGA-GCAAGTGTAGATTTGAAAAGTGGAGTGGCAAATAATGTGAAAAC
JMFN034B23- GAAGGAAAGGGGGA-GCAAGTGTAGATTTGAAAAGTGGAGTGGCAAATAATGTGAAAACA
rJMFF004E04+ GAAGGAAAGGGGGA-GCAAGTGTAGATTTGAAAAGTGGAGTGGCAAATAATGTGAAAACA
                      ____________________________________________________________
consensus GAAGGAAAGGGGGA-GCAAGTGTAGATTTGAAAAGTGGAGTGGCAAATAATGTGAAAACA
 
. : . : . : . : . : . :
rJMFF030P17+ CCT
rJMFF006C07+ CCTTANATGCAGGGGTGTAATGGTAATT
rJMSF047P10+ CCT
JMFN031M24- CCTTAAATGCAGGGGTGTAATGGTAATTTCAATTATACAT
rJMSF011L22+ CCT
JMFN034B23- CCTTAAATGCAGGGGTGTAATGGTAATTTCAATTATACATAAATTTCTCATCTAAATGTT
rJMFF004E04+ CCTTAAATGCAGGGGTGTAATGGTAATTTCAATTATACATAAATTTCTCATCTAAATGTT
                      ____________________________________________________________
consensus CCTTAAATGCAGGGGTGTAATGGTAATTTCAATTATACATAAATTTCTCATCTAAATGTT
 
. : . : . : . : . : . :
JMFN034B23- TGTAAGTTTCCTTTTGGTACAACAATGATTCTTCTCCCAATGTATTGCTACTTCATT
rJMFF004E04+ TGTAAGTTTCCTTTTGGTACAACAATGATTCTTCTCCCAATGTATTGCTACTTCATTATT
                      ____________________________________________________________
consensus TGTAAGTTTCCTTTTGGTACAACAATGATTCTTCTCCCAATGTATTGCTACTTCATTATT