Previous Contig 008316:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004D24Sequence482014118gb:ATAC009325_15428872e-17Arabidopsis thaliana chromosome III BAC F4P13 genomic sequence, complete sequenc695008316 (2)gb:ATAC009325_15428872e-15Arabidopsis thaliana chromosome III BAC F4P13 genomic sequence, complete sequenc
JMFF005O23Sequence422008316 (2)gb:ATAC009325_15428871e-13Arabidopsis thaliana chromosome III BAC F4P13 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF004D24+ CCCGGAAGAGAGGACTTATACACCTCATTCCTATA
                      ____________________________________________________________
consensus CCCGGAAGAGAGGACTTATACACCTCATTCCTATA
 
. : . : . : . : . : . :
rJMFF004D24+ ACCCAACAATCACAGAATCTCCCTTCAAGTATCCCGGTGGCCAGTTTGCTCAACATCCCT
                      ____________________________________________________________
consensus ACCCAACAATCACAGAATCTCCCTTCAAGTATCCCGGTGGCCAGTTTGCTCAACATCCCT
 
. : . : . : . : . : . :
rJMFF004D24+ ATTCAGACTTTACCAATCAGGTAAAACCCACCCATCATCCTTCAGGAAGTCAGTACTCAG
                      ____________________________________________________________
consensus ATTCAGACTTTACCAATCAGGTAAAACCCACCCATCATCCTTCAGGAAGTCAGTACTCAG
 
. : . : . : . : . : . :
rJMFF004D24+ AATTTTCTGACAGTACTAATAAGCCATATGGGTTTGGTAATTATAATGACACAAGTCCAT
                      ____________________________________________________________
consensus AATTTTCTGACAGTACTAATAAGCCATATGGGTTTGGTAATTATAATGACACAAGTCCAT
 
. : . : . : . : . : . :
rJMFF005O23+ CTGGATAGGGAAAACCAAA
rJMFF004D24+ TCTCTACCATGAAAACCTCTGAATTCTCTTCTCCTTGGGCCCTGGATAGGGAAAACCAAA
                      ____________________________________________________________
consensus TCTCTACCATGAAAACCTCTGAATTCTCTTCTCCTTGGGCCCTGGATAGGGAAAACCAAA
 
. : . : . : . : . : . :
rJMFF005O23+ ATACTCAGTACTCACATGNTCACAAGATTTTGTTACCACATGCTCTTCCAACTGCTTCCT
rJMFF004D24+ ATACTCAGTACTCACATGCTCACAAGATTTTGTTACCACATGCTCTTCCAACTGCTTCCT
                      ____________________________________________________________
consensus ATACTCAGTACTCACATGCTCACAAGATTTTGTTACCACATGCTCTTCCAACTGCTTCCT
 
. : . : . : . : . : . :
rJMFF005O23+ TTGTGGCCAGTACTGAACCAAGCACTGGAGGAACTGGAAACACAGCCCCTAATGATGAGG
rJMFF004D24+ TTGTGGCCAGTACTGAACCAAGCACTGGAGGAACTGGAAACACAGCCCCTAATGATGAGG
                      ____________________________________________________________
consensus TTGTGGCCAGTACTGAACCAAGCACTGGAGGAACTGGAAACACAGCCCCTAATGATGAGG
 
. : . : . : . : . : . :
rJMFF005O23+ ATGTTGTTGAAAAGGTTACACGCATGGGATTCAGGAGAGATTTAGTAAAGGCAACAGTGA
rJMFF004D24+ ATGTTGTTGAAAAGGTTACACGCATGGGATTCAGGAGAGATTTAGTAAAGGCAACAGTGA
                      ____________________________________________________________
consensus ATGTTGTTGAAAAGGTTACACGCATGGGATTCAGGAGAGATTTAGTAAAGGCAACAGTGA
 
. : . : . : . : . : . :
rJMFF005O23+ AAAAGCTTGCAGACAACGGGCAGTCGGTGGACCTCAATGAGGTCCTTGATAAATTGATGA
rJMFF004D24+ AAAAGCTTGCAGACAACGGGCAGTCGGTGGACCTCAATGAGGTCCTTGATAAATTGATGA
                      ____________________________________________________________
consensus AAAAGCTTGCAGACAACGGGCAGTCGGTGGACCTCAATGAGGTCCTTGATAAATTGATGA
 
. : . : . : . : . : . :
rJMFF005O23+ ACAATTGAAATATGTACATGGGGGTGTGGTTGAGTGGAATGGACTTATCCATCCTTAACC
rJMFF004D24+ ACAATTGAAATATGTACATGGGGGTGTGGTTGAGTGGAATGGACTTATCCATCCTTAACC
                      ____________________________________________________________
consensus ACAATTGAAATATGTACATGGGGGTGTGGTTGAGTGGAATGGACTTATCCATCCTTAACC
 
. : . : . : . : . : . :
rJMFF005O23+ AAACGTCAAGTGTTCGATCATTGGCTTTGCGTATGGAGCAGCTTTAAATCTCCAGGC
rJMFF004D24+ AAACGTCAAGTGTTCGATCATTGGCTTTGCGTATGGAGCAGCTTTAAATCTCCAGGCTAG
                      ____________________________________________________________
consensus AAACGTCAAGTGTTCGATCATTGGCTTTGCGTATGGAGCAGCTTTAAATCTCCAGGCTAG
 
. : . : . : . : . : . :
rJMFF004D24+ TTGTCCCACCTATTAGAGGTGCTTACAATTCAGGGCGAGGGGATTAGTCACGGGTCCGAC
                      ____________________________________________________________
consensus TTGTCCCACCTATTAGAGGTGCTTACAATTCAGGGCGAGGGGATTAGTCACGGGTCCGAC