Previous Contig 008313:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004D08Sequence503008313 (2)sp|P34788|RS18_ARATH5e-7440S ribosomal protein S18.>pir|S46223|S37496 ribosomal protein S18.A, cytosolic 676008313 (2)sp|P34788|RS18_ARATH1e-7040S ribosomal protein S18.>pir|S46223|S37496 ribosomal protein S18.A, cytosolic

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF004D08- GGAACCCCAACC-TTC
rJMFF004D08+ GGAACCCCAACCTTTC
                      ____________________________________________________________
consensus GGAACCCCAACCTTTC
 
. : . : . : . : . : . :
JMFF004D08- GTTCACAGTTCAGGCATACAGTTCAGCGGAGAGCGAGAGAGGGGAGAGAAAGCCATAATC
rJMFF004D08+ GTTCACAGTTCAGGCATACAGTTCAGCGGAGAGCGAGAGAGGGGAGAGAAAGCCATAATC
                      ____________________________________________________________
consensus GTTCACAGTTCAGGCATACAGTTCAGCGGAGAGCGAGAGAGGGGAGAGAAAGCCATAATC
 
. : . : . : . : . : . :
JMFF004D08- ATGAGTCTGGTCGCGAACGAGGATTTCCAGCACATTTTGCGTATCCTGAACACCAATGTC
rJMFF004D08+ ATGAGTCTGGTCGCGAACGAGGATTTCCAGCACATTTTGCGTATCCTGAACACCAATGTC
                      ____________________________________________________________
consensus ATGAGTCTGGTCGCGAACGAGGATTTCCAGCACATTTTGCGTATCCTGAACACCAATGTC
 
. : . : . : . : . : . :
JMFF004D08- GATGGGAAGCAGAAGATTATGTTTGCTATGACTTCCATCAAAGGTATTGGTCGCCGCTTC
rJMFF004D08+ GATGGGAAGCAGAAGATTATGTTTGCTATGACTTCCATCAAAGGTATTGGTCGCCGCTTC
                      ____________________________________________________________
consensus GATGGGAAGCAGAAGATTATGTTTGCTATGACTTCCATCAAAGGTATTGGTCGCCGCTTC
 
. : . : . : . : . : . :
JMFF004D08- GCCAATATCTGCTGCAAAAAAGCCGATATCGACATGAACAAAAGGGCTGGGGAACTTACT
rJMFF004D08+ GCCAATATCTGCTGCAAAAAAGCCGATATCGACATGAACAAAAGGGCTGGGGAACTTACT
                      ____________________________________________________________
consensus GCCAATATCTGCTGCAAAAAAGCCGATATCGACATGAACAAAAGGGCTGGGGAACTTACT
 
. : . : . : . : . : . :
JMFF004D08- GCTGCTGAAATTGATAACTTGATGACCGTTGTTGCAAACCCTCGCCAGTTCAAGGTCCCT
rJMFF004D08+ GCTGCTGAAATTGATAACTTGATGACCGTTGTTGCAAACCCTCGCCAGTTCAAGGTCCCT
                      ____________________________________________________________
consensus GCTGCTGAAATTGATAACTTGATGACCGTTGTTGCAAACCCTCGCCAGTTCAAGGTCCCT
 
. : . : . : . : . : . :
JMFF004D08- GACTGGTTTTTGAACAGGCAGAAGGACTATAAGGATGGTAACTATTCACAGGTTGTCTCC
rJMFF004D08+ GACTGGTTTTTGAACAGGCAGAAGGACTATAAGGATGGTAACTATTCACAGGTTGTCTCC
                      ____________________________________________________________
consensus GACTGGTTTTTGAACAGGCAGAAGGACTATAAGGATGGTAACTATTCACAGGTTGTCTCC
 
. : . : . : . : . : . :
JMFF004D08- AATGCATTGGATATGAAGCTTAGGGATGACCTTGAACGCCTGAAGAAAATCAGAAACCAC
rJMFF004D08+ AATGCATTGGATATGAAGCTTAGGGATGACCTTGAACGCCTGAAGAAAATCAGAAACCAC
                      ____________________________________________________________
consensus AATGCATTGGATATGAAGCTTAGGGATGACCTTGAACGCCTGAAGAAAATCAGAAACCAC
 
. : . : . : . : . : . :
JMFF004D08- CGTGGTCTCCGACACTACTGGGGGCTCCGTGTACGTGGACAGCACACCAAGACAACTGGG
rJMFF004D08+ CGTGGTCTCCGACACTACTGGGGGCTCCGTGTACGTGGACAGCACACCAAGACAACTGGG
                      ____________________________________________________________
consensus CGTGGTCTCCGACACTACTGGGGGCTCCGTGTACGTGGACAGCACACCAAGACAACTGGG
 
. : . : . : . : . : . :
JMFF004D08- CGTAGGGG
rJMFF004D08+ CGTAGGGGAAAGACTGTTGGTGTCTCGAAGAAGCGTTGATTTTGGTTGCATTCGAATCAT
                      ____________________________________________________________
consensus CGTAGGGGAAAGACTGTTGGTGTCTCGAAGAAGCGTTGATTTTGGTTGCATTCGAATCAT
 
. : . : . : . : . : . :
rJMFF004D08+ GGATGGTTTTGTTTTAGAATATATTTATATCTTTTATTTGTGATATTAGTATTTAGTACT
                      ____________________________________________________________
consensus GGATGGTTTTGTTTTAGAATATATTTATATCTTTTATTTGTGATATTAGTATTTAGTACT
 
. : . : . : . : . : . :
rJMFF004D08+ AGTACTTTTTAAAGCTAAAAGCATGAGCTTCCATGTTTTTGTCAAGCAGGCATGATTTCA
                      ____________________________________________________________
consensus AGTACTTTTTAAAGCTAAAAGCATGAGCTTCCATGTTTTTGTCAAGCAGGCATGATTTCA