Previous Contig 008303:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004A07Sequence313008303 (8)761008303 (8)pir|T05619|T056193e-53hypothetical protein F20D10.40 - Arabidopsis thaliana>gb:ATCHRIV88_1547746 Arabi
JMSF006K22Sequence322008303 (8)gb:BT002988_16365715e-08Arabidopsis thaliana clone RAFL15-26-D09 (R20506) unknown protein (At4g37920) mR412008303 (8)pir|T05619|T056193e-36hypothetical protein F20D10.40 - Arabidopsis thaliana>gb:ATCHRIV88_1547746 Arabi
JMSF018C07Sequence389008303 (8)gb:BT002988_16365718e-17Arabidopsis thaliana clone RAFL15-26-D09 (R20506) unknown protein (At4g37920) mR750008303 (8)pir|T05619|T056194e-99hypothetical protein F20D10.40 - Arabidopsis thaliana>gb:ATCHRIV88_1547746 Arabi
JMSF048N23Sequence678008303 (8)pir|T05619|T056199e-57hypothetical protein F20D10.40 - Arabidopsis thaliana>gb:ATCHRIV88_1547746 Arabi738008303 (8)pir|T05619|T056195e-78hypothetical protein F20D10.40 - Arabidopsis thaliana>gb:ATCHRIV88_1547746 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF004A07- GGATTCCACTCTGAACGCAGCCATGAGCAAC
JMSF006K22- GGATTCCACTCTGAACGCAGCCATGAGCAAC
JMSF018C07- GATTGGATTCCACTCTGAACGCAGCCATTAGCAAC
JMSF048N23- GGATTCCACTCTGAACGCAGCCATGAGCAAC
                      ____________________________________________________________
consensus GATTGGATTCCACTCTGAACGCAGCCATGAGCAAC
 
. : . : . : . : . : . :
JMFF004A07- CTCATAGGATTGAAGACCTCAATATCCACTATTATCTTTCCATTCAACGCAGAAATACCA
JMSF006K22- CTCATAGGATTGAAGACCTCAATATCCACTATTATCTTTCCATTCAACGCAGAAATACCA
JMSF018C07- CTCATAGGATTGAAGACCTCAATATCCACTATTATCTTTCCATTCAACGCAGAAATACCA
JMSF048N23- CTCATAGGATTGAAGACCTCAATATCCACTATTATCTTTCCATTCAACGCAGAAATACCA
                      ____________________________________________________________
consensus CTCATAGGATTGAAGACCTCAATATCCACTATTATCTTTCCATTCAACGCAGAAATACCA
 
. : . : . : . : . : . :
JMFF004A07- AAATCTTCCCCCAAAATTTCAACCATATCCCCATCGAAACCTACAACAACATCACCCACC
JMSF006K22- AAATCTTCCCCCAAAATTTCAACCATATCCCCATCGAAACCTACAACAACATCACCCACC
JMSF018C07- AAATCTTCCCCCAAAATTTCAACCATATCCCCATCGAAACCTACAACAACATCACCCACC
JMSF048N23- AAATCTTCCCCCAAAATTTCAACCATATCCCCATCGAAACCTACAACAACATCACCCACC
                      ____________________________________________________________
consensus AAATCTTCCCCCAAAATTTCAACCATATCCCCATCGAAACCTACAACAACATCACCCACC
 
. : . : . : . : . : . :
JMFF004A07- ATCTCCGCAACCA
JMSF006K22- ATCTCCGCAACCAAGATTTTGGCCACCAGTGTTTCTGCTGTACCAGTAGAGGAGCAACAA
JMSF018C07- ATCTCCGCAACCAAGATTTTGGCCACCAGTGTTTCTGCTGTACCAGTAGAGGAGCAACAA
JMSF048N23- ATCTCCGCAACCAAGATTTTGGCCACCAGTGTTTCTGCTGTACCAGTAGAGGAGCAACAA
                      ____________________________________________________________
consensus ATCTCCGCAACCAAGATTTTGGCCACCAGTGTTTCTGCTGTACCAGTAGAGGAGCAACAA
 
. : . : . : . : . : . :
JMSF006K22- GTTGAGGTTGAAATTGCAGATGGCTACACAATGACCCAATTTTGCGACAAGGTTATTGAC
JMSF018C07- GTTGAGGTTGAAATTGCAGATGGCTACACAATGACCCAATTTTGCGACAAGGTTATTGAC
JMSF048N23- GTTGAGGTTGAAATTGCAGATGGCTACACAATGACCCAATTTTGCGACAAGGTTATTGAC
                      ____________________________________________________________
consensus GTTGAGGTTGAAATTGCAGATGGCTACACAATGACCCAATTTTGCGACAAGGTTATTGAC
 
. : . : . : . : . : . :
JMSF006K22- ATGTTCTTGACTGAGAAACCCAAGCCCAAGGATTGGAAGAAGTACTTGGT
JMSF018C07- ATGTTCTTGACTGAGAAACCCAAGCCCAAGGATTGGAAGAAGTACTTGGTGTTTCGTGAA
JMSF048N23- ATGTTCTTGACTGAGAAACCCAAGCCCAAGGATTGGAAGAAGTACTTGGTGTTTCGTGAA
                      ____________________________________________________________
consensus ATGTTCTTGACTGAGAAACCCAAGCCCAAGGATTGGAAGAAGTACTTGGTGTTTCGTGAA
 
. : . : . : . : . : . :
JMSF018C07- GAGTGGAAAAAGTACAGGGGTAGGTTTTACACCCGGTGTCAAACCCGAGCTGAT
JMSF048N23- GAGTGGAAAAAGTACAGGGGTAGGTTTTACACCCGGTGTCAAACCCGAGCTGATGCCCAA
                      ____________________________________________________________
consensus GAGTGGAAAAAGTACAGGGGTAGGTTTTACACCCGGTGTCAAACCCGAGCTGATGCCCAA
 
. : . : . : . : . : . :
JMSF048N23- CAAAATGACCCTGCAATCAAAGAAAAATATACTAGTTTAGCAAGAAAAGTTAAGAAGATT
                      ____________________________________________________________
consensus CAAAATGACCCTGCAATCAAAGAAAAATATACTAGTTTAGCAAGAAAAGTTAAGAAGATT
 
. : . : . : . : . : . :
JMSF048N23- GATGATGAAATGGAGAGGCACGAGGACCTTCTCAAAGAGATACAGGATAGTCCTAGGGAT
                      ____________________________________________________________
consensus GATGATGAAATGGAGAGGCACGAGGACCTTCTCAAAGAGATACAGGATAGTCCTAGGGAT
 
. : . : . : . : . : . :
JMSF048N23- GTTAATGCCATCGTTACCAAGAGGCGCAAAGACTTCACTGGTGAATTCTTTCGTTATCTG
rJMSF018C07+ TTCTTTCGTTATCTG
                      ____________________________________________________________
consensus GTTAATGCCATCGTTACCAAGAGGCGCAAAGACTTCACTGGTGAATTCTTTCGTTATCTG
 
. : . : . : . : . : . :
JMSF048N23- ACTTTGTTGTCAGAAACTTATGATAGCTTGGAGGACCGAGATGCTATGGCCAGACTTGGA
rJMSF018C07+ ACTTTGTTGTCAGAAACTTATGATAGCTTGGAGGACCGAGATGCTATGGCCAGACTTGGA
                      ____________________________________________________________
consensus ACTTTGTTGTCAGAAACTTATGATAGCTTGGAGGACCGAGATGCTATGGCCAGACTTGGA
 
. : . : . : . : . : . :
JMSF048N23- GCAAGATGCCTAACTGCAGTGAGTGCTCATGATAACACACTGGAGA
rJMSF018C07+ GCAAGATGCCTAACTGCAGTGAGTGCTCATGATAACACACTGGAGATTGTGGAGACACTA
                      ____________________________________________________________
consensus GCAAGATGCCTAACTGCAGTGAGTGCTCATGATAACACACTGGAGATTGTGGAGACACTA
 
. : . : . : . : . : . :
rJMSF018C07+ GACACGGCCCAGCAAAAATTTGATGACATCCTAAACTCTCCTTCACTTGATGCAGCATGT
                      ____________________________________________________________
consensus GACACGGCCCAGCAAAAATTTGATGACATCCTAAACTCTCCTTCACTTGATGCAGCATGT
 
. : . : . : . : . : . :
rJMSF018C07+ GAGAAGATTCAAAGCCTTGCCAAGACAAAAGAACTTGACTCTTCATTGATTCTATTGATA
                      ____________________________________________________________
consensus GAGAAGATTCAAAGCCTTGCCAAGACAAAAGAACTTGACTCTTCATTGATTCTATTGATA
 
. : . : . : . : . : . :
rJMSF018C07+ AACGGTGCTTGGGCGGCGGCTAAAGACTCCACCACCATGAGAAATGAGGTAAAAGACATA
rJMSF048N23+ AGGTAAAAGACATA
rJMFF004A07+ AGGTAAAAGACATA
                      ____________________________________________________________
consensus AACGGTGCTTGGGCGGCGGCTAAAGACTCCACCACCATGAGAAATGAGGTAAAAGACATA
 
. : . : . : . : . : . :
rJMSF018C07+ ATGTATCACCTGTACAAGACCACTCAGAGTAGTCTGAGGAGTATGGCACCAAAAGAAATA
rJMSF048N23+ ATGTATCACCTGTACAAGACCACTCAGAGTAGTCTGAGGAGTATGGCACCAAAAGAAATA
rJMFF004A07+ ATGTATCACCTGTACAAGACCACTCAGAGTAGTCTGAGGAGTATGGCACCAAAAGAAATA
                      ____________________________________________________________
consensus ATGTATCACCTGTACAAGACCACTCAGAGTAGTCTGAGGAGTATGGCACCAAAAGAAATA
 
. : . : . : . : . : . :
rJMSF018C07+ AAACTACTTAAGTATTTGCTTAACATTATAGATCCCGAGGAAAGATTCTCTGCATTGGCT
rJMSF048N23+ AAACTACTTAAGTATTTGCTTAACATTATAGATCCCGAGGAAAGATTCTCTGCATTGGCT
rJMSF006K22+ TTAACATTATAGATCCCGAGGAAAGATTCTCTGCATTGGCT
rJMFF004A07+ AAACTACTTAAGTATTTGCTTAACATTATAGATCCCGAGGAAAGATTCTCTGCATTGGCT
                      ____________________________________________________________
consensus AAACTACTTAAGTATTTGCTTAACATTATAGATCCCGAGGAAAGATTCTCTGCATTGGCT
 
. : . : . : . : . : . :
rJMSF018C07+ ACAGCTTTTAGTCCTGGTGATGAACATGGAGCTAAAGACCCAAGTGCTATATACACAACT
rJMSF048N23+ ACAGCTTTTAGTCCTGGTGATGAACATGGAGCTAAAGACCCAAGTGCTATATACACAACT
rJMSF006K22+ ACAGCTTTTAGTCCTGGTGATGAACATGGAGCTAAAGACCCAAGTGCTATATACACAACT
rJMFF004A07+ ACAGCTTTTAGTCCTGGTGATGAACATGGAGCTAAAGACCCAAGTGCTATATACACAACT
                      ____________________________________________________________
consensus ACAGCTTTTAGTCCTGGTGATGAACATGGAGCTAAAGACCCAAGTGCTATATACACAACT
 
. : . : . : . : . : . :
rJMSF018C07+ CCCAAGGAGCTACATAAATGGATAAAAATCATGTTAGATGCATACCACCTCAACCAAGAA
rJMSF048N23+ CCCAAGGAGCTACATAAATGGATAAAAATCATGTTAGATGCATACCACCTCAACCAAGAA
rJMSF006K22+ CCCAAGGAGCTACATAAATGGATAAAAATCATGTTAGATGCATACCACCTCAACCAAGAA
rJMFF004A07+ CCCAAGGAGCTACATAAATGGATAAAAATCATGTTAGATGCATACCACCTCAACCAAGAA
                      ____________________________________________________________
consensus CCCAAGGAGCTACATAAATGGATAAAAATCATGTTAGATGCATACCACCTCAACCAAGAA
 
. : . : . : . : . : . :
rJMSF018C07+ GAAACTGAAATTAGGGAAGCAAAACAGATGAACCAACCTGTTGTTATCCAGAGGCTTTGC
rJMSF048N23+ GAAACTGAAATTAGGGAAGCAAAACAGATGAACCAACCTGTTGTTATCCAGAGGCTTTGC
rJMSF006K22+ GAAANTGAAATTAGGGAAGCAAAACAGATGAACCAACNTGTTGTTATCCAGAGGCTTTGC
rJMFF004A07+ GAAACTGAAATTAGGGAAGCAAAACAGATGAACCAACCTGTTGTTATCCAGAGGCTTTGC
                      ____________________________________________________________
consensus GAAACTGAAATTAGGGAAGCAAAACAGATGAACCAACCTGTTGTTATCCAGAGGCTTTGC
 
. : . : . : . : . : . :
rJMSF018C07+ ATCCTTAAGGAAGTCATTGAAGAGGAATACTTGGAGCAACAAGTTAATGCAGAAAAAGAC
rJMSF048N23+ ATCCTTAAGGAAGTCATTGAAGAGGAATACTTGGAGCAACAAGTTAATGCAGAAAAAGAC
rJMSF006K22+ ATCCTTAAGGAAGTCATTGAAGAGGAATACTTGGAGCANCAAGTTAATGCAGAAAAAGAC
rJMFF004A07+ ATCCTTAAGGAAGTCATTGAAGAGGAATACTTGGAGCAACAAGTTAATGCAGAAAAAGAC
                      ____________________________________________________________
consensus ATCCTTAAGGAAGTCATTGAAGAGGAATACTTGGAGCAACAAGTTAATGCAGAAAAAGAC
 
. : . : . : . : . : . :
rJMSF018C07+ CCGAAATCAGAAGAGTTGTGAGG
rJMSF048N23+ CCGAAATCAGAAGAGTTGTGAGGTACAACTAGTAGTATCAAAGATGACTACTTTGCCCTT
rJMSF006K22+ CCGAAATCAGAAGAGTTGTGAGGTACAACTAGTAGTATCAAAGATGNCTACTTTGCCCTN
rJMFF004A07+ CCGAAATCAGAAGAGTTGTGAGGTACAACTAGTAGTATCAAAGATGACTACTTTGCCCTT
                      ____________________________________________________________
consensus CCGAAATCAGAAGAGTTGTGAGGTACAACTAGTAGTATCAAAGATGACTACTTTGCCCTT
 
. : . : . : . : . : . :
rJMSF048N23+ GATGTCTAGACAAATGATTTGCCTATGTCCCTCCATATGCAGGCTTAGTATACCCAGACC
rJMSF006K22+ GATNTCTAGNCAANTGATTTGCCTATGTCCCTCCATATGCAGGCTTNGTATACCCAGACC
rJMFF004A07+ GATGTCTAGACAAATGATTTGCCTATGTCCCTCCATATGCAGGCTTAGTATACCCAGACC
                      ____________________________________________________________
consensus GATGTCTAGACAAATGATTTGCCTATGTCCCTCCATATGCAGGCTTAGTATACCCAGACC
 
. : . : . : . : . : . :
rJMSF048N23+ CAGTCTAGCCCTTTTGTACAGTTGATGAATGATCATTATGGAAA
rJMSF006K22+ CAGTCTAGCCC
rJMFF004A07+ CAGTCTAGCCCTTTTGTACAGTTGATGAATGATCATTATGGAAATATCAAACCCACAAGT
                      ____________________________________________________________
consensus CAGTCTAGCCCTTTTGTACAGTTGATGAATGATCATTATGGAAATATCAAACCCACAAGT