Previous Contig 008298:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003P01Sequence755008298 (11)pir|F86247|F862471e-31protein T23J18.3 [imported] - Arabidopsis thaliana>gb:AE005172_890144 Arabidopsi
JMFF004N15Sequence520008298 (11)pir|F86247|F862471e-36protein T23J18.3 [imported] - Arabidopsis thaliana>gb:AE005172_890144 Arabidopsi736008298 (11)pir|F86247|F862473e-41protein T23J18.3 [imported] - Arabidopsis thaliana>gb:AE005172_890144 Arabidopsi
JMFF012B03Sequence485008298 (11)pir|F86247|F862478e-32protein T23J18.3 [imported] - Arabidopsis thaliana>gb:AE005172_890144 Arabidopsi744008298 (11)pir|F86247|F862471e-40protein T23J18.3 [imported] - Arabidopsis thaliana>gb:AE005172_890144 Arabidopsi
JMFF027B23Sequence509008298 (11)pir|F86247|F862472e-32protein T23J18.3 [imported] - Arabidopsis thaliana>gb:AE005172_890144 Arabidopsi700008298 (11)pir|F86247|F862478e-37protein T23J18.3 [imported] - Arabidopsis thaliana>gb:AE005172_890144 Arabidopsi
JMFF033G17Sequence539008298 (11)pir|F86247|F862476e-46protein T23J18.3 [imported] - Arabidopsis thaliana>gb:AE005172_890144 Arabidopsi742008298 (11)pir|F86247|F862471e-40protein T23J18.3 [imported] - Arabidopsis thaliana>gb:AE005172_890144 Arabidopsi
JMFF038L19Sequence501008298 (11)pir|F86247|F862472e-35protein T23J18.3 [imported] - Arabidopsis thaliana>gb:AE005172_890144 Arabidopsi699008298 (11)pir|F86247|F862478e-37protein T23J18.3 [imported] - Arabidopsis thaliana>gb:AE005172_890144 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF027B23- GGGAGCGAAAGTCTCTTCTCTTCTCATTT
JMFF038L19- ATTT
JMFF012B03- ATTT
JMFF004N15- CTCTTCTCTTCTCATTT
                      ____________________________________________________________
consensus GGGAGCGAAAGTCTCTTCTCTTCTCATTT
 
. : . : . : . : . : . :
JMFF027B23- GTTTCTTGCAGAAGTCAAAAGGACGGAAAATCGGTCAACGTTAAGAAAAACCCTAACCCC
JMFF038L19- GTTTCTTGCAGAAGTCAAAAGGACGGAAAATCGGTCAACGTTAAGAAAAACCCTAACCCC
JMFF012B03- GTTTCTTGCAGAAGTCAAAAGGACGGAAAATCGGTCAACGTTAAGAAAAACCCTAACCCC
JMFF004N15- GTTTCTTGCAGAAGTCAAAAGGACGGAAAATCGGTCAACGTTAAGAAAAACCCTAACCCC
JMFF033G17- GCAGAAGTCAAAAGGACGGAAAATCGGTCAACGTTAAGAAAAACCCTAACCCC
                      ____________________________________________________________
consensus GTTTCTTGCAGAAGTCAAAAGGACGGAAAATCGGTCAACGTTAAGAAAAACCCTAACCCC
 
. : . : . : . : . : . :
JMFF027B23- CCGGGAATTCTCCAGAAAATGCAGCAAAATCAGGCGAACTCCGTGGATTCCGACCTCCCG
JMFF038L19- CCGGGAATTCTCCAGAAAATGCAGCAAAATCAGGCGAACTCCGTGGATTCCGACCTCCCG
JMFF012B03- CCGGGAATTCTCCAGAAAATGCAGCAAAATCAGGCGAACTCCGTGGATTCCGACCTCCCG
JMFF004N15- CCGGGAATTCTCCAGAAAATGCAGCAAAATCAGGCGAACTCCGTGGATTCCGACCTCCCG
JMFF033G17- CCGGGAATTCTCCAGAAAATGCAGCAAAATCAGGCGAACTCCGTGGATTCCGACCTCCCG
                      ____________________________________________________________
consensus CCGGGAATTCTCCAGAAAATGCAGCAAAATCAGGCGAACTCCGTGGATTCCGACCTCCCG
 
. : . : . : . : . : . :
JMFF027B23- CGTCTCGCCAATATCAAAGTCCGGTCGTCGTCTCCGCGCTTTCCGCCGCCGACCACTCCT
JMFF038L19- CGTCTCGCCAATATCAAAGTCCGGTCGTCGTCTCCGCGCTTTCCGCCGCCGACCACTCCT
JMFF012B03- CGTCTCGCCAATATCAAAGTCCGGTCGTCGTCTCCGCGCTTTCCGCCGCCGACCACTCCT
JMFF004N15- CGTCTCGCCAATATCAAAGTCCGGTCGTCGTCTCCGCGCTTTCCGCCGCCGACCACTCCT
JMFF033G17- CGTCTCGCCAATATCAAAGTCCGGTCGTCGTCTCCGCGCTTTCCGCCGCCGACCACTCCT
                      ____________________________________________________________
consensus CGTCTCGCCAATATCAAAGTCCGGTCGTCGTCTCCGCGCTTTCCGCCGCCGACCACTCCT
 
. : . : . : . : . : . :
JMFF027B23- TCTTCTAACGAAACCCCGACCGCCGGAGCTCAGCGAAGGATTGGCATCGCCGTGGACCTC
JMFF038L19- TCTTCTAACGAAACCCCGACCGCCGGAGCCCAGCGAAGGATTGGCATCGCCGTGGACCTC
JMFF012B03- TCTTCTAACGAAACCCCGACCGCCGGAGCTCAGCGAAGGATTGGCATCGCCGTGGACCTC
JMFF004N15- TCTTCTAACGAAACCCCGACCGCCGGAGCTCAGCGAAGGATTGGCATCGCCGTGGACCTC
JMFF033G17- TCTTCTAACGAAACCCCGACCGCCGGAGCTCAGCGAAGGATTGGCATCGCCGTGGACCTC
                      ____________________________________________________________
consensus TCTTCTAACGAAACCCCGACCGCCGGAGCTCAGCGAAGGATTGGCATCGCCGTGGACCTC
 
. : . : . : . : . : . :
JMFF027B23- AGCGATGAGTCCGCCTTTGCTGTCAAGTGGGCTGTGCACCAGTACCTCCGCCCTGGCGAT
JMFF038L19- AGCGATGAGTCCGCCTTTGCTGTCAAGTGGGCTGTGCACCAGTACCTCCGCCCTGGCGAT
JMFF012B03- AGCGATGAGTCCGCCTTTGCTGTCAAGTGGGCTGTGCACCAGTACCTCCGCCCTGGCGAT
JMFF004N15- AGCGATGAGTCCGCCTTTGCTGTCAAGTGGGCTGTGCACCAGTACCTCCGCCCTGGCGAT
JMFF033G17- AGCGATGAGTCCGCCTTTGCTGTCAAGTGGGCTGTGCACCAGTACCTCCGCCCTGGCGAT
                      ____________________________________________________________
consensus AGCGATGAGTCCGCCTTTGCTGTCAAGTGGGCTGTGCACCAGTACCTCCGCCCTGGCGAT
 
. : . : . : . : . : . :
JMFF027B23- GCCGTGATTCTCGTCCACGTGCGCCCCACCTCGGTGCTCTACGGTGCTGACTGGGGATCT
JMFF038L19- GCCGTGATTCTCGTCCACGTGCGCCCCACCTCGGTGCTCTACGGTGCTGACTGGGGATCT
JMFF012B03- GCCGTGATTCTCGTCCACGTGCGCCCCACCTCGGTGCTCTACGGTGCTGACTGGGGATCT
JMFF004N15- GCCGTGATTCTCGTCCACGTGCGCCCCACCTCGGTGCTCTACGGTGCTGACTGGGGATCT
JMFF033G17- GCCGTGATTCTCGTCCACGTGCGCCCCACCTCGGTGCTCTACGGTGCTGACTGGGGATCT
rJMFF033G17+ TACGGTGCTGACTGGGGATCT
rJMFF004N15+ TACGGTGCTGACTGGGGATCT
rJMFF012B03+ TCTACGGTGCTGACTGGGGATCT
                      ____________________________________________________________
consensus GCCGTGATTCTCGTCCACGTGCGCCCCACCTCGGTGCTCTACGGTGCTGACTGGGGATCT
 
. : . : . : . : . : . :
JMFF027B23- GTTGACCTCTCCATCGTCGACACTGACAACGAGGAGTCGCAGCAGAAGCTGGAGGACGAT
JMFF038L19- GTTGACCTCTCCATCGTCGACACTGACAACGAGGAGTCGCAGCAGAAGCTGGAGGACGAT
JMFF012B03- GTTGACCTCTCCATCGTCGACACTGACAACGAGGAGTCGCAGCAGAATCTGGAGGACGAT
JMFF004N15- GTTGACCTCTCCATCGTCGACACTGACAACGAGGAGTCGCAGCAGAAGCTGGAGGACGAT
JMFF033G17- GTTGACCTCTCCATCGTCGACACTGACAACGAGGAGTCGCAGCAGAAGCTGGAGGACGAT
rJMFF027B23+ TCGACACTGACAACGAGGAGTCGCAGCAGAAGCTGGAGGACGAT
rJMFF033G17+ GTTGACNTCTCCATCGTCGACACTGACAACGAGGAGTCGCAGCAGAAGCTGGAGGACGAT
rJMFF038L19+ CGTCGACACTGACAACGAGGAGTCGCAGCAGAAGCTGGAGGACGAT
rJMFF004N15+ GTTGACCTCTCCATCGTCGACACTGACAACGAGGAGTCGCAGCAGAAGCTGGAGGACGAT
rJMFF012B03+ GTTGACCTCTCCATCGTCGACACTGACAACGAGGAGTCGCAGCAGAATCTGGAGGACGAT
rJMFF003P01+ ACAACGAGGAGTCGCAGCAGAAGCTGGAGGACGAT
                      ____________________________________________________________
consensus GTTGACCTCTCCATCGTCGACACTGACAACGAGGAGTCGCAGCAGAAGCTGGAGGACGAT
 
. : . : . : . : . : . :
JMFF027B23- TTCGACACTTTCACCATCACTAAGGCCTCCGATCTGGCTCAGCCGCTGGTGGACGCGCAG
JMFF038L19- TTCGACACTTTCACCATCACTAAGGCCTCCGATCTGGCTCAGCCGCTGGTGGACGCGCAG
JMFF012B03- TTCGACACTTTCACCATCACTAAGGCCTCCGATCTGGCTCAGCCGCTGGTGGACGCGCAG
JMFF004N15- TTCGACACTTTCACCATCACTAAGGCCTCCGATCTGGCTCAGCCGCTGGTGGACGCGCAG
JMFF033G17- TTCGACACTTTCACCATCACTAAGGCCTCCGATCTGGCTCAGCCGCTGGTGGACGCGCAG
rJMFF027B23+ TTCGACACTTTCACCATCACTAAGGCCTCCGATCTGGCTCAGCCGCTGGTGGACGCGCAG
rJMFF033G17+ TTCGACACTTTCACCATCACTAAGGCCTCCGATCTGGCTCAGCCGCTGGTGGACGCGCAG
rJMFF038L19+ TTCGACACTTTCACCATCACTAAGGCCTCCGATCTGGCTCAGCCGCTGGTGGACGCGCAG
rJMFF004N15+ TTCGACACTTTCACCATCACTAAGGCCTCCGATCTGGCTCAGCCGCTGGTGGACGCGCAG
rJMFF012B03+ TTCGACACTTTCACCATCACTAAGGCCTCCGATCTGGCTCAGCCGCTGGTGGACGCGCAG
rJMFF003P01+ TTCGACACTTTCACCATCACTAAGGCNTCCGATCTGGCTCAGCCGCTGGTGGACGCGCAG
                      ____________________________________________________________
consensus TTCGACACTTTCACCATCACTAAGGCCTCCGATCTGGCTCAGCCGCTGGTGGACGCGCAG
 
. : . : . : . : . : . :
JMFF038L19- ATTCCGTTCAAAATCCA
JMFF012B03- A
JMFF004N15- ATTCCGTTCAAAATCCACATCGT
JMFF033G17- ATTCCGTTCAAAATCCACATCGTGAAGGACCACGATATG-AAGGAGAGGCTCTGCCTCGA
rJMFF027B23+ ATTCCGTTCAAAATCCACATCGTGAAGGACCACGATATG-AAGGAGAGGCTCTGCCTCGA
rJMFF033G17+ ATTCCGTTCAAAATCCACATCGTGAAGGACCACGATATG-AAGGAGAGGCTCTGCCTCGA
rJMFF038L19+ ATTCCGTTCAAAATCCACATCGTGAAGGACCACGATATG-AAGGAGAGGCTCTGCCTCGA
rJMFF004N15+ ATTCCGTTCAAAATCCACATCGTGAAGGACCACGATATG-AAGGAGAGGCTCTGCCTCGA
rJMFF012B03+ ATTCCGTTCAAAATCCACATCGTGAAGGACCACGATATG-AAGGAGAGGCTCTGCCTCGA
rJMFF003P01+ ATTCCGTTCAAAATCCACATCGTGAAGGACCACGATATGAAAGGAGAGGCTCTGCCTCGA
                      ____________________________________________________________
consensus ATTCCGTTCAAAATCCACATCGTGAAGGACCACGATATG-AAGGAGAGGCTCTGCCTCGA
 
. : . : . : . : . : . :
JMFF033G17- AGTCGAG
rJMFF027B23+ AGTCGAGAGGTTAGGACTCAACGCCGTCATCATGGGGAGCCGTGGATTTGGGGCTACTAG
rJMFF033G17+ AGTCGAGAGGTTAGGACTCAACGCCGTCATCATGGGGAGCCGTGGATTTGGGGCTACTAG
rJMFF038L19+ AGTCGAGAGGTTAGGACTCAACGCCGTCATCATGGGGAGCCGTGGATTTGGGGCTACTAG
rJMFF004N15+ AGTCGAGAGGTTAGGACTCAACGCCGTCATCATGGGGAGCCGTGGATTTGGGGCTACTAG
rJMFF012B03+ AGTCGAGAGGTTAGGACTCAACGCCGTCATCATGGGGAGCCGTGGATTTGGGGCTACTAG
rJMFF003P01+ AGTCGAGAGGTTAGGACTCAACGCCGTCATCATGGGGAGCCGTGGATTTGGGGCTACTAG
                      ____________________________________________________________
consensus AGTCGAGAGGTTAGGACTCAACGCCGTCATCATGGGGAGCCGTGGATTTGGGGCTACTAG
 
. : . : . : . : . : . :
rJMFF027B23+ GAAAGGAAACAACGGCAGGCTTGGAAGCGTCAGTGATTACTGTGTTAGGCATTGCGTTTG
rJMFF033G17+ GAAAGGAAACAACGGCAGGCTTGGAAGCGTCAGTGATTACTGTGTTAGGCATTGCGTTTG
rJMFF038L19+ GAAAGGAAACAACGGCAGGCTTGGAAGCGTCAGTGATTACTGTGTTAGGCATTGCGTTTG
rJMFF004N15+ GAAAGGAAACAACGGCAGGCTTGGAAGCGTCAGTGATTACTGTGTTAGGCATTGCGTTTG
rJMFF012B03+ GAAAGGAAACAACGGCAGGCTTGGAAGCGTCAGTGATTACTGTGTTAGGCATTGCGTTTG
rJMFF003P01+ GAAAGGAAACAACGGCAGGCTTGGAAGCGTCAGTGATTACTGTGTTAGGCATTGCGTTTG
                      ____________________________________________________________
consensus GAAAGGAAACAACGGCAGGCTTGGAAGCGTCAGTGATTACTGTGTTAGGCATTGCGTTTG
 
. : . : . : . : . : . :
rJMFF027B23+ CCCTGTTGTGGTTGTCAGGTATCCTGACGAGAAGGATGCTGGAAATGCTAACGCTGAACC
rJMFF033G17+ CCCTGTTGTGGTTGTCAGGTATCCTGACGAGAAGGATGCTGGAAATGCTAACGCTGAACC
rJMFF038L19+ CCCTGTTGTGGTTGTCAGGTATCCTGACGAGAAGGATGCTGGAAATGCTAACGCTGAACC
rJMFF004N15+ CCCTGTTGTGGTTGTCAGGTATCCTGACGAGAAGGATGCTGGAAATGCTAACGCTGAACC
rJMFF012B03+ CCCTGTTGTGGTTGTCAGGTATCCTGACGAGAAGGATGCTGGAAATGCTAACGCTGAACC
rJMFF003P01+ CCCTGTTGTGGTTGTCAGGTATCCTGACGAGAAGGATGCTGGAAATGCTAACGCTGAACC
                      ____________________________________________________________
consensus CCCTGTTGTGGTTGTCAGGTATCCTGACGAGAAGGATGCTGGAAATGCTAACGCTGAACC
 
. : . : . : . : . : . :
rJMFF027B23+ TGTGATCTCTGTTGCATCCGTGGCAGAGGAGGAAGATGAACCAGAGTACCACGATGCACA
rJMFF033G17+ TGTGATCTCTGTTGCATCCGTGGCAGAGGAGGAAGATGAACCAGAGTACCACGATGCACA
rJMFF038L19+ TGTGATCTCTGTTGCATCCGTGGCAGAGGAGGAAGATGAACCAGAGTACCACGATGCACA
rJMFF004N15+ TGTGATCTCTGTTGCATCCGTGGCAGAGGAGGAAGATGAACCAGAGTACCACGATGCACA
rJMFF012B03+ TGTGATCTCTGTTGCATCCGTGGCAGAGGAGGAAGATGAACCAGAGTACCACGATGCACA
rJMFF003P01+ TGTGATCTCTGTTGCATCCGTGGCAGAGGAGGAAGATGAACCAGAGTACCACGATGCACA
                      ____________________________________________________________
consensus TGTGATCTCTGTTGCATCCGTGGCAGAGGAGGAAGATGAACCAGAGTACCACGATGCACA
 
. : . : . : . : . : . :
rJMFF027B23+ TGATGATCGCAAAGATTCGTGATTGTAATTTGGAGCGCTGCTCATTACATCCTGTCTTGG
rJMFF033G17+ TGATGATCGCAAAGATTCGTGATTGTAATTTGGAGCGCTGCTCATTACATCCTGTCTTGG
rJMFF038L19+ TGATGATCGCAAAGATTCGTGATTGTAATTTGGAGCGCTGCTCATTACATCCTGTCTTGG
rJMFF004N15+ TGATGATCGCAAAGATTCGTGATTGTAATTTGGAGCGCTGCTCATTACATCCTGTCTTGG
rJMFF012B03+ TGATGATCGCAAAGATTCGTGATTGTAATTTGGAGCGCTGCTCATTACATCCTGTCTTGG
rJMFF003P01+ TGATGATCGCAAAGATTCGTGATTGTAATTTGGAGCGCTGCTCATTACATCCTGTCTTGG
                      ____________________________________________________________
consensus TGATGATCGCAAAGATTCGTGATTGTAATTTGGAGCGCTGCTCATTACATCCTGTCTTGG
 
. : . : . : . : . : . :
rJMFF027B23+ CTGAGGTGCCAAGTGTAGAAGGACCGGAGTCTACAAACTATAACCCTGTTTAATGATGCG
rJMFF033G17+ CTGAGGTGCCAAGTGTAGAAGGACCGGAGTCTACAAACTATAACCCTGTTTAATGATGCG
rJMFF038L19+ CTGAGGTGCCAAGTGTAGAAGGACCGGAGTCTACAAACTATAACCCTGTTTAATGATGCG
rJMFF004N15+ CTGAGGTGCCAAGTGTAGAAGGACCGGAGTCTACAAACTATAACCCTGTTTAATGATGCG
rJMFF012B03+ CTGAGGTGCCAAGTGTAGAAGGACCGGAGTCTACAAACTATAACCCTGTTTAATGATGCG
rJMFF003P01+ CTGAGGTGCCAAGTGTAGAAGGACCGGAGTCTACAAACTATAACCCTGTTTAATGATGCG
                      ____________________________________________________________
consensus CTGAGGTGCCAAGTGTAGAAGGACCGGAGTCTACAAACTATAACCCTGTTTAATGATGCG
 
. : . : . : . : . : . :
rJMFF027B23+ TAGTCGCTAATGAGTCTTGCAATGTATGAATGTCATCCTATGTAAATGAAACCTGGAAAC
rJMFF033G17+ TAGTCGCTAATGAGTCTTGCAATGTATGAATGTCATCCTATGTAAATGAAACCTGGAAAC
rJMFF038L19+ TAGTCGCTAATGAGTCTTGCAATGTATGAATGTCATCCTATGTAAATGAAACCTGGAAAC
rJMFF004N15+ TAGTCGCTAATGAGTCTTGCAATGTATGAATGTCATCCTATGTAAATGAAACCTGGAAAC
rJMFF012B03+ TAGTCGCTAATGAGTCTTGCAATGTATGAATGTCATCCTATGTAAATGAAACCTGGAAAC
rJMFF003P01+ TAGTCGCTAATGAGTCTTGCAATGTATGAATGTCATCCTATGTAAATGAAACCTGGAAAC
                      ____________________________________________________________
consensus TAGTCGCTAATGAGTCTTGCAATGTATGAATGTCATCCTATGTAAATGAAACCTGGAAAC
 
. : . : . : . : . : . :
rJMFF027B23+ TCTTCTGTTGAGTCTTGTATTCACAGTTTACCTGTGTGAACTGTGATAAATGTATCGTTT
rJMFF033G17+ TCTTCTGTTGAGTCTTGTATTCACAGTTTACCTGTGTGAACTGTGATAAATGTATCGTTT
rJMFF038L19+ TCTTCTGTTGAGTCTTGTATTCACAGTTTACCTGTGTGAACTGTGATAAATGTATCGTTT
rJMFF004N15+ TCTTCTGTTGAGTCTTGTATTCACAGTTTACCTGTGTGAACTGTGATAAATGTATCGTTT
rJMFF012B03+ TCTTCTGTTGAGTCTTGTATTCACAGTTTACCTGTGTGAACTGTGATAAATGTATCGTTT
rJMFF003P01+ TCTTCTGTTGAGTCTTGTATTCACAGTTTACCTGTGTGAACTGTGATAAATGTATCGTTT
                      ____________________________________________________________
consensus TCTTCTGTTGAGTCTTGTATTCACAGTTTACCTGTGTGAACTGTGATAAATGTATCGTTT
 
. : . : . : . : . : . :
rJMFF027B23+ GGTATTTTCGGATCAGCATCATTGTGCTGTTCATTGTGATGCTGCAACTTCCAAATT
rJMFF033G17+ GGTATTTTCGGATCAGCATCATTGTGCTGTTCATTGTGATGCTGCAACTTCCAAATT
rJMFF038L19+ GGTATTTTCGGATCAGCATCATTGTGCTGTTCATTGTGATGCTGCAACTTCCAA
rJMFF004N15+ GGTATTTTCGGATCAGCATCATTGTGCTGTTCATTGTGATGCTGCAACTTCCAAAT
rJMFF012B03+ GGTATTTTCGGATCAGCATCATTGTGCTGTTCATTGTGATGCTGCAACTTCCAAATT
rJMFF003P01+ GGTATTTTCGGATCAGCATCATTGTGCTGTTCATTGTGATGCTGCAACTTCCAAATTTCT
                      ____________________________________________________________
consensus GGTATTTTCGGATCAGCATCATTGTGCTGTTCATTGTGATGCTGCAACTTCCAAATTTCT
 
. : . : . : . : . : . :
rJMFF003P01+ GAATGTGAATTCCATATTTTTATATCTCCTACTTATTCTCAGAGACAATTACATTATGAA
                      ____________________________________________________________
consensus GAATGTGAATTCCATATTTTTATATCTCCTACTTATTCTCAGAGACAATTACATTATGAA