Previous Contig 008293:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003N15Sequence493000019 (14)gb:AB016061_15127549e-42Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.678008293 (3)gb:AB016061_15127544e-57Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFN034O12Sequence624008293 (3)gb:AB016061_15127542e-83Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMSF012A17Sequence199000019 (14)gb:SCO939113_1763430.004Streptomyces coelicolor A3(2) complete genome; segment 10/29.776008293 (3)gb:AB016061_15127544e-82Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN034O12- CGCATGAACAAAGATAGACAGGAGAGCGGAAAGAGGAAAG
                      ____________________________________________________________
consensus CGCATGAACAAAGATAGACAGGAGAGCGGAAAGAGGAAAG
 
. : . : . : . : . : . :
JMFN034O12- ATTTCTTGGATGTATTGCTCGAGTTTGAAGGCAATGGAAAGGATGAACCAGCCAAGCTAT
rJMSF012A17+ T
                      ____________________________________________________________
consensus ATTTCTTGGATGTATTGCTCGAGTTTGAAGGCAATGGAAAGGATGAACCAGCCAAGCTAT
 
. : . : . : . : . : . :
JMFN034O12- CAGAACATGAAATCAATATATTTGTAATGGAAATATTTTTCGCTGGTACAGAGACGACTA
rJMSF012A17+ CAGAACATGAAATCAATATATTTGTAATGGAAATATTTTTCGCTGGTACAGAGACGACTA
                      ____________________________________________________________
consensus CAGAACATGAAATCAATATATTTGTAATGGAAATATTTTTCGCTGGTACAGAGACGACTA
 
. : . : . : . : . : . :
JMFN034O12- GCAGCAGTGTGGAATGGGCACTAAGTGAGCTCTTGTGTAACCCAAAAGTGATGGCTAAAG
rJMSF012A17+ GCAGCAGTGTGGAATGGGCACTAAGTGAGCTCTTGTGTAACCCAAAAGTGATGGCTAAAG
rJMFF003N15+ CAAAAGTGATGGCTAAAG
                      ____________________________________________________________
consensus GCAGCAGTGTGGAATGGGCACTAAGTGAGCTCTTGTGTAACCCAAAAGTGATGGCTAAAG
 
. : . : . : . : . : . :
JMFN034O12- TCAAAGAAGAGATTTATGAAGTTGTAGGACCAAACCGGAGATTTGAGGAAAGTGATATTG
rJMSF012A17+ TCAAAGAAGAGATTTATGAAGTTGTAGGACCAAACCGGAGATTTGAGGAAAGTGATATTG
rJMFF003N15+ TCAAAGAAGAGATTTATGAAGTTGTAGGNCCAAACCGGAGATTTGAGGAAAGTGATATTG
                      ____________________________________________________________
consensus TCAAAGAAGAGATTTATGAAGTTGTAGGACCAAACCGGAGATTTGAGGAAAGTGATATTG
 
. : . : . : . : . : . :
JMFN034O12- ATAATCTGCAGTACATGCAGGCAGTGGTCAAGGAAACACTACGTTTGCATCCCCCTGTTG
rJMSF012A17+ ATAATCTGCAGTACATGCAGGCAGTGGTCAAGGAAACACTACGTTTGCATCCCCCTGTTG
rJMFF003N15+ ATAATCTGCAGTNCATGCAGGCAGTGGTCAAGGAAACACTNCGTTTGCATCCCCCTGTTG
                      ____________________________________________________________
consensus ATAATCTGCAGTACATGCAGGCAGTGGTCAAGGAAACACTACGTTTGCATCCCCCTGTTG
 
. : . : . : . : . : . :
JMFN034O12- CTTTCTTAGTGCCAAGAAGAGCAATTCAAGATACTAAATTTATGGAGTACGACATACCTA
rJMSF012A17+ CTTTCTTAGTGCCAAGAAGAGCAATTCAAGATACTAAATTTATGGAGTACGACATACCTA
rJMFF003N15+ CTTTCTTAGTGCCAAGAAGAGCAATTCAAGATANTAAATTTATGGAGTNCGACATACNTA
                      ____________________________________________________________
consensus CTTTCTTAGTGCCAAGAAGAGCAATTCAAGATACTAAATTTATGGAGTACGACATACCTA
 
. : . : . : . : . : . :
JMFN034O12- AAGACACTCAAGTCTTCGTAAATGTTTGGGCAATTGGAAGAGACCCTGAAAGCTGGGATG
rJMSF012A17+ AAGACACTCAAGTCTTCGTAAATGTTTGGGCAATTGGAAGAGACCCTGAAAGCTGGGATG
rJMFF003N15+ AAGACACTCAAGTCTTTGTAAATGTTTGGGCAATNGGAAGAGACCCTGAAAGCTGGGATG
                      ____________________________________________________________
consensus AAGACACTCAAGTCTTCGTAAATGTTTGGGCAATTGGAAGAGACCCTGAAAGCTGGGATG
 
. : . : . : . : . : . :
JMFN034O12- ACCCTCTATCTTTCAAGCCGGAGAGATTCCTGGGCTCAAACACAGACTTCAAGGGGCAGG
rJMSF012A17+ ACCCTCTATCTTTCAAGCCGGAGAGATTCCTGGGCTCAAACACAGACTTCAAGGGGCAGG
rJMFF003N15+ ACCCTCTATCTTTCAAGCCGGAGAGATTCNTGGGCTCAAACACAGACTTCAAGGGGCAGG
                      ____________________________________________________________
consensus ACCCTCTATCTTTCAAGCCGGAGAGATTCCTGGGCTCAAACACAGACTTCAAGGGGCAGG
 
. : . : . : . : . : . :
JMFN034O12- ATTTTGAATTTCTACCATTTGGTGCAGGCCGGAGGATCTGTGTAGGCCTCCCGTTAGGTA
rJMSF012A17+ ATTTTGAATTTCTACCATTTGGTGCAGGCCGGAGGATCTGTGTAGGCCTCCCGTTAGGTA
rJMFF003N15+ ATTTTGAATTTNTACCATNNGGTGCAGGCCGGAGGATCTGTGTAGGCCTCCCGTTAGGTA
                      ____________________________________________________________
consensus ATTTTGAATTTCTACCATTTGGTGCAGGCCGGAGGATCTGTGTAGGCCTCCCGTTAGGTA
 
. : . : . : . : . : . :
JMFN034O12- ATGGATGCTGCATTTCATTCTGGGATCGCTGCTCCATGCCTTCG
rJMSF012A17+ ATGGATGCTGCATTTCATTCTGGGATCGCTGCTCCATGCCTTCGACTGGGAGCTCGAATT
rJMFF003N15+ ATGGATGNTGCATTTCATTCTGGGATCGNTGCTCCATGCNTTCGANTGGGAGCTNGAATT
                      ____________________________________________________________
consensus ATGGATGCTGCATTTCATTCTGGGATCGCTGCTCCATGCCTTCGACTGGGAGCTCGAATT
 
. : . : . : . : . : . :
rJMSF012A17+ CAATGTGACCTCACAATCTCTGGACATGAAAGAAAGGAAGGGAGTAGCAGCTAGCAAATC
rJMFF003N15+ CAATGTGACCTCNCAATCTCTGNACATGAAAGAAAGGAAGGGAGTAGCAGNTAGCAAATC
                      ____________________________________________________________
consensus CAATGTGACCTCACAATCTCTGGACATGAAAGAAAGGAAGGGAGTAGCAGCTAGCAAATC
 
. : . : . : . : . : . :
rJMSF012A17+ TGAACCCCTGAAAGCAATACCAAGGAGAATTGTAGCTTGAAAGAAGTTACAAGTCTTAGT
rJMFF003N15+ TGNACCCCTGAAAGCAATNCCAAGGAGAATTGTAGCTTGAAAGAAGTTACAAGTNTTAGT
                      ____________________________________________________________
consensus TGAACCCCTGAAAGCAATACCAAGGAGAATTGTAGCTTGAAAGAAGTTACAAGTCTTAGT
 
. : . : . : . : . : . :
rJMSF012A17+ GCATTTGCATTCAGACCTGTTATGACTTATACTGTTTTACTTGCTGAAGAATAATCTCAG
rJMFF003N15+ GCATTNGCATTCAGACCTGNTATGACTTATACTGTTTTACTTGCTGAAGAATAATCTCAG
                      ____________________________________________________________
consensus GCATTTGCATTCAGACCTGTTATGACTTATACTGTTTTACTTGCTGAAGAATAATCTCAG
 
. : . : . : . : . : . :
rJMSF012A17+ TGCACA
rJMFF003N15+ TGCACATGCATGTAATAATGTAATATTGATCTGCTTGCAACTATAAGATTTGCTTATCAT
                      ____________________________________________________________
consensus TGCACATGCATGTAATAATGTAATATTGATCTGCTTGCAACTATAAGATTTGCTTATCAT