Previous Contig 008286:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003K19Sequence621008286 (2)gb:ATF2I11_15504642e-50Arabidopsis thaliana DNA chromosome 5, BAC clone F2I11 (ESSA project).>gb:BT0040649008286 (2)gb:ATF2I11_15504643e-50Arabidopsis thaliana DNA chromosome 5, BAC clone F2I11 (ESSA project).>gb:BT0040

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF003K19- AAATTTTGTCTGTTTTCTTTTCTAATTTTCTCTCCCATCGTGTTCTATT
rJMFF003K19+ AAATTTTGTCTGTTTTCTTTTCTAATTTTCTCTCCCATCGTGTTCTATT
                      ____________________________________________________________
consensus AAATTTTGTCTGTTTTCTTTTCTAATTTTCTCTCCCATCGTGTTCTATT
 
. : . : . : . : . : . :
JMFF003K19- TCATAGGAGTTGAGGCTAGAGGGTTCATGTTCGGTCCACCTATCGCCCTAGCAATCGGTG
rJMFF003K19+ TCATAGGAGTTGAGGCTAGAGGGTTCATGTTCGGTCCACCTATCGCCCTAGCAATCGGTG
                      ____________________________________________________________
consensus TCATAGGAGTTGAGGCTAGAGGGTTCATGTTCGGTCCACCTATCGCCCTAGCAATCGGTG
 
. : . : . : . : . : . :
JMFF003K19- CCAAGTTTGTTCCGTTACGTAAGCCAGGAAAATTGCCAGGTGAAGTGATCTCGGAAGCCT
rJMFF003K19+ CCAAGTTTGTTCCGTTACGTAAGCCAGGAAAATTGCCAGGTGAAGTGATCTCGGAAGCCT
                      ____________________________________________________________
consensus CCAAGTTTGTTCCGTTACGTAAGCCAGGAAAATTGCCAGGTGAAGTGATCTCGGAAGCCT
 
. : . : . : . : . : . :
JMFF003K19- ATGAACTAGAGTATGGTCGGGATTGTTTGGAGATGCATGTGGGTGCCGTAGAGAAGGGGG
rJMFF003K19+ ATGAACTAGAGTATGGTCGGGATTGTTTGGAGATGCATGTGGGTGCCGTAGAGAAGGGGG
                      ____________________________________________________________
consensus ATGAACTAGAGTATGGTCGGGATTGTTTGGAGATGCATGTGGGTGCCGTAGAGAAGGGGG
 
. : . : . : . : . : . :
JMFF003K19- ACCGGGTAGTGGTAATTGACGATTTGATAGCTACAGGAGGGACTCTCTCGGCTGCCATAA
rJMFF003K19+ ACCGGGTAGTGGTAATTGACGATTTGATAGCTACAGGAGGGACTCTCTCGGCTGCCATAA
                      ____________________________________________________________
consensus ACCGGGTAGTGGTAATTGACGATTTGATAGCTACAGGAGGGACTCTCTCGGCTGCCATAA
 
. : . : . : . : . : . :
JMFF003K19- ACCTTCTAGAACGGATGGGAGCTGAAGTCGTTGAATGCGGTTGTGTTATTGGATTGCCAG
rJMFF003K19+ ACCTTCTAGAACGGATGGGAGCTGAAGTCGTTGAATGCGGTTGTGTTATTGGATTGCCAG
                      ____________________________________________________________
consensus ACCTTCTAGAACGGATGGGAGCTGAAGTCGTTGAATGCGGTTGTGTTATTGGATTGCCAG
 
. : . : . : . : . : . :
JMFF003K19- AAGTCGAGGGACAAAACAGGCTAAAAGGGAGGCCAGTTTATATGCTTGTCGAACCCCGGG
rJMFF003K19+ AAGTCGAGGGACAAAACAGGCTAAAAGGGAGGCCAGTTTATATGCTTGTCGAACCCCGGG
                      ____________________________________________________________
consensus AAGTCGAGGGACAAAACAGGCTAAAAGGGAGGCCAGTTTATATGCTTGTCGAACCCCGGG
 
. : . : . : . : . : . :
JMFF003K19- AATTAGATGACTCGTTTTGAAATTTCGAGATATGGAAATTGACATGCTGGAGTCTATCAA
rJMFF003K19+ AATTAGATGACTCGTTTTGAAATTTCGAGATATGGAAATTGACATGCTGGAGTCTATCAA
                      ____________________________________________________________
consensus AATTAGATGACTCGTTTTGAAATTTCGAGATATGGAAATTGACATGCTGGAGTCTATCAA
 
. : . : . : . : . : . :
JMFF003K19- GAAGAGATGATGATGGGAAAAAAAGCTTCCAAATCTTTCACATCAACTAATGATTCTATA
rJMFF003K19+ GAAGAGATGATGATGGGAAAAAAAGCTTCCAAATCTTTCACATCAACTAATGATTCTATA
                      ____________________________________________________________
consensus GAAGAGATGATGATGGGAAAAAAAGCTTCCAAATCTTTCACATCAACTAATGATTCTATA
 
. : . : . : . : . : . :
JMFF003K19- CCATCTTCTAGTGTCTATTCAGTTCCATTATTAGCTTCTTTTCTTCATTGCTTGATCATT
rJMFF003K19+ CCATCTTCTAGTGTCTATTCAGTTCCATTATTAGCTTCTTTTCTTCATTGCTTGATCATT
                      ____________________________________________________________
consensus CCATCTTCTAGTGTCTATTCAGTTCCATTATTAGCTTCTTTTCTTCATTGCTTGATCATT
 
. : . : . : . : . : . :
JMFF003K19- TTATTTATTTTTCTAAGAGAAATTTGTGCTGA
rJMFF003K19+ TTATTTATTTTTCTAAGAGAAATTTGTGCTGAGATGAACAGTGAGGATATCTGAAGCATA
                      ____________________________________________________________
consensus TTATTTATTTTTCTAAGAGAAATTTGTGCTGAGATGAACAGTGAGGATATCTGAAGCATA