Previous Contig 008283:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003K10Sequence561008283 (28)gb:AF442385_18002351e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.670008283 (28)gb:AF442385_18002352e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.
JMFF019O02Sequence585008283 (28)gb:AF442385_18002351e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.676008283 (28)gb:AF442385_18002352e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.
JMFF024D06Sequence499008283 (28)gb:AF442385_18002352e-66Capsicum annuum thioredoxin peroxidase mRNA, complete cds.693008283 (28)gb:AF442385_18002352e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.
JMFF025E24Sequence585008283 (28)gb:AF442385_18002351e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.751008283 (28)gb:AF442385_18002352e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.
JMFF030G05Sequence541008283 (28)gb:AY281152_15946725e-73Lycopersicon esculentum thioredoxin peroxidase 1 (TPx1) mRNA, complete cds.620008283 (28)gb:AF442385_18002353e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.
JMFF035G16Sequence576008283 (28)gb:AF442385_18002358e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.714008283 (28)gb:AF442385_18002351e-75Capsicum annuum thioredoxin peroxidase mRNA, complete cds.
JMFF039C22Sequence518008283 (28)gb:AF442385_18002352e-70Capsicum annuum thioredoxin peroxidase mRNA, complete cds.
JMFF043G01Sequence632008283 (28)gb:AF442385_18002356e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.660008283 (28)gb:AY281152_15946722e-55Lycopersicon esculentum thioredoxin peroxidase 1 (TPx1) mRNA, complete cds.
JMFF046M16Sequence565008283 (28)gb:AF442385_18002351e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.563008283 (28)gb:AY281152_15946722e-49Lycopersicon esculentum thioredoxin peroxidase 1 (TPx1) mRNA, complete cds.
JMFF050M15Sequence630008283 (28)gb:AF442385_18002352e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.629008283 (28)gb:AY281152_15946723e-53Lycopersicon esculentum thioredoxin peroxidase 1 (TPx1) mRNA, complete cds.
JMFN005A05Sequence623008283 (28)gb:AF442385_18002351e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.
JMSF006O23Sequence318008283 (28)gb:AY281152_15946727e-36Lycopersicon esculentum thioredoxin peroxidase 1 (TPx1) mRNA, complete cds.396008283 (28)gb:AF442385_18002357e-28Capsicum annuum thioredoxin peroxidase mRNA, complete cds.
JMSF016A14Sequence509008283 (28)gb:AF442385_18002351e-67Capsicum annuum thioredoxin peroxidase mRNA, complete cds.722008283 (28)gb:AF442385_18002352e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.
JMSF018M07Sequence506008283 (28)gb:AF442385_18002353e-67Capsicum annuum thioredoxin peroxidase mRNA, complete cds.724008283 (28)gb:AF442385_18002352e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.
JMSF052A22Sequence630008283 (28)gb:AF442385_18002352e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.698008283 (28)gb:AF442385_18002352e-76Capsicum annuum thioredoxin peroxidase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF043G01- CCTTATGGCGGATCACCCTGGAGAGXXXXX
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTGGAGAGNNNNN
 
. : . : . : . : . : . :
rJMFF050M15- AATCAAAAGATTTCTGACAATAAAAACATGAACTGATAATCTGTTCA
rJMFF046M16- TTTCTGACAATAAAAACATGAACTGATAATCTGTTCA
rJMFF043G01- XXXXXXXXXXXXXAATCAAAAGATTTCTGACAATAAAAACATGAACTGATAATCTGTTCA
rJMFF024D06- GAACTGATAATCTGTTCA
rJMFF035G16- TGAACTGATAATCTGTTCA
rJMFF025E24- GAACTGATAATCTGTTCA
                      ____________________________________________________________
consensus NNNNNNNNNNNNNAATCAAAAGATTTCTGACAATAAAAACATGAACTGATAATCTGTTCA
 
. : . : . : . : . : . :
rJMFF050M15- GGATCAACAAATATATGATTCGACAACATTGCATATGTAGAAAAGCATTTCATATCATAA
rJMFF046M16- GGATCAACAAATATATGATTCGACAACATTGCATATGTAGAAAAGCATTTCATATCATAC
rJMFF043G01- GGATCAACAAATATATGATTCGACAACATTGCATATGTAGAAAAGCATTTCATATCATAA
rJMSF006O23- ACAAATATATGATTCGACAACATTGCATATGTAGAAAAGCATTTCATATCATAA
rJMFF024D06- GGATCAACAAATATATGATTCGACAACATTGCATATGTAGAAAAGCATTTCATATCATAA
rJMFF035G16- GGATCAACAAATATATGATTCGACAACATTGCATATGTAGAAAAGCATTTCATATCATAA
rJMSF016A14- AATATATGATTCGACAACATTGCATATGTAGAAAAGCATTTCATATCATAA
rJMSF018M07- ACAAATATATGATTCGACAACATTGCATATGTAGAAAAGCATTTCATATCATAA
rJMFF025E24- GGATCAACAAATATATGATTCGACAACATTGCATATGTAGAAAAGCATTTCATATCATAA
rJMSF052A22- AAGCATTTCATATCATAA
                      ____________________________________________________________
consensus GGATCAACAAATATATGATTCGACAACATTGCATATGTAGAAAAGCATTTCATATCATAA
 
. : . : . : . : . : . :
rJMFF050M15- AATAACCGAATATGTCATTTTTAAGAGCAAAAGTCATTTTATTTCAAAAAGATAGGACAG
rJMFF046M16- AATAACCGAATATGTCATTTTTAAGAGCAAAAGTCATTTTATTTCAAAAAGATAGGACAG
rJMFF043G01- AATAACCGAATATGTCATTTTTAAGAGCAAAAGTCATTTTATTTCAAAAAGATAGGACAG
rJMSF006O23- AATAACCGAATATGTCATTTTTAAGAGCAAAAGTCATTTTATTTCAAAAAGATAGGACAG
rJMFF024D06- AATAACCGAATATGTCATTTTTAAGAGCAAAAGTCATTTTATTTCAAAAAGATAGGACAG
rJMFF035G16- AATAACCGAATATGTCATTTTTAAGAGCAAAAGTCATTTTATTTCAAAAAGATAGGACAG
rJMSF016A14- AATAACCGAATATGTCATTTTTAAGAGCAAAAGTCATTTTATTTCAAAAAGATAGGACAG
rJMSF018M07- AATAACCGAATATGTCATTTTTAAGAGCAAAAGTCATTTTATTTCAAAAAGATAGGACAG
JMFN005A05+ GTCATTTTATTTCAAAAAGATAGGACAG
rJMFF025E24- AATAACCGAATATGTCATTTTTAAGAGCAAAAGTCATTTTATTTCAAAAAGATAGGACAG
rJMSF052A22- AATAACCGAATATGTCATTTTTAAGAGCAAAAGTCATTTTATTTCAAAAAGATAGGACAG
JMFF043G01+ TTCAAAAAGATAGGACAG
JMSF052A22+ GATAGGACAG
rJMFF030G05- G
rJMFF019O02- AACCGAATATGTCATTTTTAAGAGCAAAAGTCATTTTATTTCAAAAAGATAGGACAG
JMFF050M15+ GATAGGACAG
rJMFF003K10- GATAGGACAG
                      ____________________________________________________________
consensus AATAACCGAATATGTCATTTTTAAGAGCAAAAGTCATTTTATTTCAAAAAGATAGGACAG
 
. : . : . : . : . : . :
rJMFF050M15- GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
rJMFF046M16- GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
rJMFF043G01- GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
rJMSF006O23- GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
rJMFF024D06- GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
rJMFF035G16- GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
rJMSF016A14- GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
rJMSF018M07- GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
JMFN005A05+ GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
rJMFF025E24- GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
rJMSF052A22- GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
JMFF043G01+ GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
JMSF052A22+ GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
rJMFF030G05- GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
rJMFF019O02- GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
JMFF046M16+ CGCAGCAACAA
JMFF019O02+ CAACAGCAATCATAACGCAGCAACAA
JMFF025E24+ CAACAGCAATCATAACGCAGCAACAA
JMFF035G16+ TCATAACGCAGCAACAA
JMFF050M15+ GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
rJMFF003K10- GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
                      ____________________________________________________________
consensus GAAAGGCCATTCATAATTGCATAGCAACTAAACACAACAGCAATCATAACGCAGCAACAA
 
. : . : . : . : . : . :
rJMFF050M15- TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
rJMFF046M16- TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
rJMFF043G01- TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
rJMSF006O23- TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
rJMFF024D06- TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
rJMFF035G16- TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
rJMSF016A14- TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
rJMSF018M07- TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
JMFN005A05+ TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
rJMFF025E24- TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
rJMSF052A22- TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
JMFF043G01+ TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
JMSF052A22+ TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
rJMFF030G05- TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
rJMFF019O02- TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
JMFF046M16+ TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
JMFF019O02+ TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
JMFF025E24+ TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
JMFF035G16+ TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
JMFF003K10+ TTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
JMFF030G05+ ATTTCATCAGCCNCAGAGACAGTGAATTCCCCACCAGATTCG
JMFF039C22+ GAATTCCCCACCAGATTCG
JMSF018M07+ GATTCG
JMSF016A14+ CCAGATTCG
JMFF050M15+ TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
rJMFF003K10- TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
                      ____________________________________________________________
consensus TCTTAGAGAGCCTTAAGGATTTCATCAGCACCAGAGACAGTGAATTCCCCACCAGATTCG
 
. : . : . : . : . : . :
rJMFF050M15- ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
rJMFF046M16- ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
rJMFF043G01- ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
rJMSF006O23- ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
rJMFF024D06- ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
rJMFF035G16- ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCCTTTAGATCGGGTG
rJMSF016A14- ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
rJMSF018M07- ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
JMFN005A05+ ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
rJMFF025E24- ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
rJMSF052A22- ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
JMFF043G01+ ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
JMSF052A22+ ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
rJMFF030G05- ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
rJMFF019O02- ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
JMFF046M16+ ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
JMFF019O02+ ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
JMFF025E24+ ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
JMFF035G16+ ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCCTTTAGATCGGGTG
JMFF003K10+ ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
JMFF030G05+ ATATTAGCGACAGTCACTTNGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
JMFF039C22+ ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
JMSF018M07+ ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
JMSF016A14+ ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
JMFF024D06+ ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
JMFF050M15+ ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
rJMFF003K10- ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
                      ____________________________________________________________
consensus ATATTAGCGACAGTCACTTTGAGATCGTCAACCAAAAGTGCAAACCTTTTAGATCGGGTG
 
. : . : . : . : . : . :
rJMFF050M15- CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
rJMFF046M16- CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
rJMFF043G01- CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
rJMSF006O23- CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
rJMFF024D06- CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
rJMFF035G16- CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
rJMSF016A14- CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
rJMSF018M07- CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
JMFN005A05+ CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
rJMFF025E24- CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
rJMSF052A22- CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
JMFF043G01+ CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
JMSF052A22+ CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
rJMFF030G05- CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTAAAGAGCCTGGGTGTACTTGCCAGAT
rJMFF019O02- CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
JMFF046M16+ CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
JMFF019O02+ CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
JMFF025E24+ CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
JMFF035G16+ CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
JMFF003K10+ CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
JMFF030G05+ CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTAAAGAGCCTGGGTGTACTTGCCAGAT
JMFF039C22+ CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
JMSF018M07+ CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
JMSF016A14+ CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
JMFF024D06+ CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
JMFF050M15+ CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
rJMFF003K10- CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
                      ____________________________________________________________
consensus CCAAGCCCTTTCTCTGAAAGGTCAAGCTCAAGGTCAAGAGCCTGGGTGTACTTGCCAGAT
 
. : . : . : . : . : . :
rJMFF050M15- CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
rJMFF046M16- CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
rJMFF043G01- CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
rJMSF006O23- CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGT
rJMFF024D06- CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
rJMFF035G16- CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
rJMSF016A14- CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
rJMSF018M07- CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
JMFN005A05+ CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
rJMFF025E24- CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
rJMSF052A22- CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
JMFF043G01+ CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
JMSF052A22+ CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
rJMFF030G05- CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
rJMFF019O02- CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
JMFF046M16+ CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
JMFF019O02+ CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
JMFF025E24+ CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
JMFF035G16+ CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
JMFF003K10+ CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
JMFF030G05+ CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
JMFF039C22+ CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
JMSF018M07+ CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
JMSF016A14+ CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
JMFF024D06+ CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
JMFF050M15+ CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
rJMFF003K10- CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
                      ____________________________________________________________
consensus CCATCGGCTAAGAACTTGACATGTTTGTTGTCGGGGTAAGTTTTTGCCCAAGCTTTCATC
 
. : . : . : . : . : . :
rJMFF050M15- ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
rJMFF046M16- ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
rJMFF043G01- ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
rJMFF024D06- ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
rJMFF035G16- ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
rJMSF016A14- ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
rJMSF018M07- ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
JMFN005A05+ ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
rJMFF025E24- ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
rJMSF052A22- ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
JMFF043G01+ ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
JMSF052A22+ ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
rJMFF030G05- ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
rJMFF019O02- ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
JMFF046M16+ ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
JMFF019O02+ ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
JMFF025E24+ ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
JMFF035G16+ ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
JMFF003K10+ ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
JMFF030G05+ ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
JMFF039C22+ ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
JMSF018M07+ ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
JMSF016A14+ ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
JMFF024D06+ ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
JMSF006O23+ AAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
JMFF050M15+ ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
rJMFF003K10- ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
                      ____________________________________________________________
consensus ACAAAGGGGTCGTTCACACTGATGCAAAGAATTTCATTAACGCCCTTTGAGATCAACTCC
 
. : . : . : . : . : . :
rJMFF050M15- TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
rJMFF046M16- TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAA
rJMFF043G01- TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
rJMFF024D06- TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
rJMFF035G16- TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
rJMSF016A14- TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
rJMSF018M07- TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
JMFN005A05+ TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
rJMFF025E24- TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
rJMSF052A22- TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
JMFF043G01+ TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGCGAAGGCCCCG
JMSF052A22+ TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
rJMFF030G05- TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
rJMFF019O02- TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
JMFF046M16+ TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
JMFF019O02+ TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
JMFF025E24+ TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
JMFF035G16+ TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
JMFF003K10+ TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
JMFF030G05+ TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
JMFF039C22+ TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
JMSF018M07+ TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
JMSF016A14+ TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
JMFF024D06+ TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
JMSF006O23+ TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
JMFF050M15+ TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
rJMFF003K10- TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
                      ____________________________________________________________
consensus TCGGATTTCTCAATAAACCCAGGCACGTGCTTCATGCTGCAAGTGGGAGTGAAGGCCCCG
 
. : . : . : . : . : . :
rJMFF043G01- GGAACGGC-AAGAGAATGACCTTTTTGCCCT
rJMFF024D06- GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
rJMFF035G16- GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
rJMSF016A14- GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
rJMSF018M07- GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
JMFN005A05+ GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
rJMFF025E24- GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
rJMSF052A22- GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
JMFF043G01+ GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
JMSF052A22+ GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
rJMFF030G05- GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
rJMFF019O02- GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
JMFF046M16+ GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
JMFF019O02+ GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
JMFF025E24+ GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
JMFF035G16+ GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
JMFF003K10+ GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGG
JMFF030G05+ GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
JMFF039C22+ GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
JMSF018M07+ GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
JMSF016A14+ GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
JMFF024D06+ GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
JMSF006O23+ GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
JMFF050M15+ GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
rJMFF003K10- GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGG
                      ____________________________________________________________
consensus GGAACGGCAAAGAGAATGACCTTTTTGCCCTTTGCGAGAGAATGGATGGACACACTCTGA
 
. : . : . : . : . : . :
rJMFF024D06- AGCTGATCTTGCTCGTCGAAGTANGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
rJMFF035G16- AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
rJMSF016A14- AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
rJMSF018M07- AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
JMFN005A05+ AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
rJMFF025E24- AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
rJMSF052A22- AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
JMFF043G01+ AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
JMSF052A22+ AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
rJMFF030G05- AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
rJMFF019O02- AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
JMFF046M16+ AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
JMFF019O02+ AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
JMFF025E24+ AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
JMFF035G16+ AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
JMFF003K10+ AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
JMFF030G05+ AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACNGCG
JMFF039C22+ AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
JMSF018M07+ AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
JMSF016A14+ AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
JMFF024D06+ AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
JMSF006O23+ AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
JMFF050M15+ AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
rJMFF003K10- AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
                      ____________________________________________________________
consensus AGCTGATCTTGCTCGTCGAAGTAGGCCAAAGTTCCGTCCGGGATAACGTCGTTAACTGCG
 
. : . : . : . : . : . :
rJMFF024D06- ATCGGCGCCATTGAT
rJMFF035G16- ATCGGCGCCATTGATTCTTTCACGATCGTCGTATA
rJMSF016A14- ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
rJMSF018M07- ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGA
JMFN005A05+ ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGA
rJMFF025E24- ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
rJMSF052A22- ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
JMFF043G01+ ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
JMSF052A22+ ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
rJMFF030G05- ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
rJMFF019O02- ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
JMFF046M16+ ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
JMFF019O02+ ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
JMFF025E24+ ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
JMFF035G16+ ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
JMFF003K10+ ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
JMFF030G05+ ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
JMFF039C22+ ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTACCTGAGAAAT
JMSF018M07+ ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
JMSF016A14+ ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
JMFF024D06+ ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTACCTGAGAAAT
JMSF006O23+ ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
JMFF050M15+ ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTACCTGAGAAAT
rJMFF003K10- ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
                      ____________________________________________________________
consensus ATCGGCGCCATTGATTCTTTCACGATCGTCGTATACACCCACTGAGGTTCCCTGAGAAAT
 
. : . : . : . : . : . :
rJMSF016A14- CAGA
rJMFF025E24- CAGAAATGGAAGA
rJMSF052A22- CAGAAATGGAAGACGAGA
JMFF043G01+ CAGAAATGGAAGAC
JMSF052A22+ CAGAAATGGAAGACGAGA
rJMFF030G05- CAGAAATGGAAGACGAGAC
rJMFF019O02- CAGAAATGGAAGACGAGAC
JMFF046M16+ CAGAAATGGAAGAC
JMFF019O02+ CAGAAATGGAAGACGAGAC
JMFF025E24+ CAGAAATGGAAGACGAGAC
JMFF035G16+ CAGAAATGGAAGACGAGAC
JMFF003K10+ CAGAAATGGAAGACGAGAC
JMFF030G05+ CAGAAATGGAAGACGAGAC
JMFF039C22+ CAGAAATGGAAGACAAGAC
JMSF018M07+ CAGAAATGGAAGACGAGACC
JMSF016A14+ CAGAAATGGAAGACGAGACC
JMFF024D06+ CAGAAATGGAAGACAAGAC
JMSF006O23+ CAGAAATGGAAGACGAGACC
JMFF050M15+ CAGAAATGGAAGACGAGACC
rJMFF003K10- CANAAATGGAAGACGAGACACTTCGGGTTCTCGAGTCATCGCTGTTCCAGACAGCGATGA
                      ____________________________________________________________
consensus CAGAAATGGAAGACGAGACCCTTCGGGTTCTCGAGTCATCGCTGTTCCAGACAGCGATGA