Previous Contig 008281:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003J22Sequence526008281 (5)sp|Q8RVQ5|SC10_ARATH5e-68Exocyst complex component Sec10.>gb:AF479280_1803516 Arabidopsis thaliana SEC10 806008281 (5)sp|Q8RVQ5|SC10_ARATH1e-87Exocyst complex component Sec10.>gb:AF479280_1803516 Arabidopsis thaliana SEC10
JMFF004I02Sequence532008281 (5)sp|Q8RVQ5|SC10_ARATH2e-68Exocyst complex component Sec10.>gb:AF479280_1803516 Arabidopsis thaliana SEC10 778008281 (5)sp|Q8RVQ5|SC10_ARATH2e-81Exocyst complex component Sec10.>gb:AF479280_1803516 Arabidopsis thaliana SEC10
JMFF042E24Sequence611004113 (7)sp|Q8RVQ5|SC10_ARATH4e-45Exocyst complex component Sec10.>gb:AF479280_1803516 Arabidopsis thaliana SEC10 618008281 (5)gb:ATT2L20_15557415e-59Arabidopsis thaliana DNA chromosome 5, BAC clone T2L20 (ESSA project).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF003J22- TTAGTCTATATGTTACAGAAGGCCTTGAGAGGGCCAGGGATAGCCTTACTGAAG
JMFF004I02- TTAGTCTATATGTTACAGAAGGCCTTGAGAGGGCCAGGGATAGCCTTACTGAAG
                      ____________________________________________________________
consensus TTAGTCTATATGTTACAGAAGGCCTTGAGAGGGCCAGGGATAGCCTTACTGAAG
 
. : . : . : . : . : . :
JMFF003J22- CTGCAGCTTTAAGGGAAAGATTTGTGTTGGGAACAAGTGTTAGTCGAAGGGTTGCTGCAG
JMFF004I02- CTGCAGCTTTAAGGGAAAGATTTGTGTTGGGAACAAGTGTTAGTCGAAGGGTTGCTGCAG
                      ____________________________________________________________
consensus CTGCAGCTTTAAGGGAAAGATTTGTGTTGGGAACAAGTGTTAGTCGAAGGGTTGCTGCAG
 
. : . : . : . : . : . :
JMFF003J22- CAGCTGCTTCTGCTGCGGAAGCAGCAGCTGCTGCTGGTGAAAGCAGTTTCAAATCTTTCA
JMFF004I02- CAGCTGCTTCTGCTGCGGAAGCAGCAGCTGCTGCTGGTGAAAGCAGTTTCAAATCTTTCA
                      ____________________________________________________________
consensus CAGCTGCTTCTGCTGCGGAAGCAGCAGCTGCTGCTGGTGAAAGCAGTTTCAAATCTTTCA
 
. : . : . : . : . : . :
JMFF003J22- TGGTGGCTGTTCAACGTTGTGGAAGCAGCGTGGCTATTGTTCAGCAATTTTTTGCCAACT
JMFF004I02- TGGTGGCTGTTCAACGTTGTGGAAGCAGCGTGGCTATTGTTCAGCAATTTTTTGCCAACT
                      ____________________________________________________________
consensus TGGTGGCTGTTCAACGTTGTGGAAGCAGCGTGGCTATTGTTCAGCAATTTTTTGCCAACT
 
. : . : . : . : . : . :
JMFF003J22- CTATTTCCCGGCTTTTGTTACCTGTGGATGGTGCCCATGCTGCTTCATGTGAAGAAATGG
JMFF004I02- CTATTTCCCGGCTTTTGTTACCTGTGGATGGTGCCCATGCTGCTTCATGTGAAGAAATGG
rJMFF003J22+ CCCATGCTGCTTCATGTGAAGAAATGG
                      ____________________________________________________________
consensus CTATTTCCCGGCTTTTGTTACCTGTGGATGGTGCCCATGCTGCTTCATGTGAAGAAATGG
 
. : . : . : . : . : . :
JMFF003J22- CAAAGGCAATGT-CCAGTGCGGAAGGTGCTGCTTATAAGGGGCTTCAACAATGCATTGAA
JMFF004I02- CAAAGGCAATGT-CCAGTGCGGAAGGTGCTGCTTATAAGGGGCTTCAACAATGCATTGAA
rJMFF004I02+ AAGGCAATGTCCCAGTGCGGAAGGTGCTGCTTATAAGGGGCTTCAACAATGCATTGAA
rJMFF003J22+ CAAAGGCAATGT-CCAGTGCGGAAGGTGCTGCTTATAAGGGGCTTCAACAATGCATTGAA
                      ____________________________________________________________
consensus CAAAGGCAATGT-CCAGTGCGGAAGGTGCTGCTTATAAGGGGCTTCAACAATGCATTGAA
 
. : . : . : . : . : . :
JMFF003J22- ACTGTTATGGCTGAGGTGGAACGTTTGCTATCAACAGAACAAAAGACAACAGATTTTCGG
JMFF004I02- ACTGTTATGGCTGAGGTGGAACGTTTGCTATCAACAGAACAAAAGACAACAGATTTTCGG
rJMFF004I02+ ACTGTTATGGCTGAGGTGGAACGTTTGCTATCAACAGAACAAAAGACAACAGATTTTCGG
rJMFF003J22+ ACTGTTATGGCTGAGGTGGAACGTTTGCTATCAACAGAACAAAAGACAACAGATTTTCGG
                      ____________________________________________________________
consensus ACTGTTATGGCTGAGGTGGAACGTTTGCTATCAACAGAACAAAAGACAACAGATTTTCGG
 
. : . : . : . : . : . :
JMFF003J22- TCACCTGATGATGGCATTGGCCCAGATCATCGACCAACAACTGCCTGTACAAGAGTTGTT
JMFF004I02- TCACCTGATGATGGCATTGGCCCANATCATCGACCAACAACTGCCTGTACAAGAGTTGTT
rJMFF004I02+ TCACCTGATGATGGCATTGGCCCAGATCATCGACCAACAACTGCCTGTACAAGAGTTGTT
rJMFF042E24+ CGACCAACAACTGCCTGTACAAGAGTTGTT
rJMFF003J22+ TCACCTGATGATGGCATTGGCCCAGATCATCGACCAACAACTGCCTGTACAAGAGTTGTT
                      ____________________________________________________________
consensus TCACCTGATGATGGCATTGGCCCAGATCATCGACCAACAACTGCCTGTACAAGAGTTGTT
 
. : . : . : . : . : . :
JMFF003J22- GCATACCTATCCCGAGTGCTTGAATCTGCATTTACTGGGCTTGATGGGCTAAA
JMFF004I02- GCATACCTATCCCGAGTGCTTGAATCTGCATTTACTGGGCTTGATGGGCTAAATAAACA
rJMFF004I02+ GCATACCTATCCCGAGTGCTTGAATCTGCATTTACTGGGCTTGATGGGCTAAATAAACAA
rJMFF042E24+ GCATACCTATCCCGAGTGCTTGAATCTGCATTTACTGGGCTTGATGGGCTAAATAAACAA
rJMFF003J22+ GCATACCTATCCCGAGTGCTTGAATCTGCATTTACTGGGCTTGATGGGCTAAATAAACAA
                      ____________________________________________________________
consensus GCATACCTATCCCGAGTGCTTGAATCTGCATTTACTGGGCTTGATGGGCTAAATAAACAA
 
. : . : . : . : . : . :
rJMFF004I02+ GCTTTCCTCACTGAACTGGGCAATCGCCTTCACAAAGGGTTGCTTAATCATTGGCAGAAG
rJMFF042E24+ GCTTTCCTCACTGAACTGGGCAATCGCCTTCACAAAGGGTTGCTTAATCATTGGCAGAAG
rJMFF003J22+ GCTTTCCTCACTGAACTGGGCAATCGCCTTCACAAAGGGTTGCTTAATCATTGGCAGAAG
                      ____________________________________________________________
consensus GCTTTCCTCACTGAACTGGGCAATCGCCTTCACAAAGGGTTGCTTAATCATTGGCAGAAG
 
. : . : . : . : . : . :
rJMFF004I02+ TTTACCTTCAATCCTAGTGGAGGACTCCGCTTGAAGCGTGATATAACTGAGTATGGAGAG
rJMFF042E24+ TTTACCTTCAATCCTAGTGGAGGACTCCGCTTGAAGCGTGATATAACTGAGTATGGAGAG
rJMFF003J22+ TTTACCTTCAATCCTAGTGGAGGACTCCGCTTGAAGCGTGATATAACTGAGTATGGAGAG
                      ____________________________________________________________
consensus TTTACCTTCAATCCTAGTGGAGGACTCCGCTTGAAGCGTGATATAACTGAGTATGGAGAG
 
. : . : . : . : . : . :
rJMFF004I02+ TTTGTTCGTAGTTTCAATGCCCCCTCAGTTGATGAGAAATTTGAATTGCTGGGCATCATG
rJMFF042E24+ TTTGTTCGTAGTTTCAATGCCCCCTCAGTTGATGAGAAATTTGAATTGCTGGGCATCATG
rJMFF003J22+ TTTGTTCGTAGTTTCAATGCCCCCTCAGTTGATGAGAAATTTGAATTGCTGGGCATCATG
                      ____________________________________________________________
consensus TTTGTTCGTAGTTTCAATGCCCCCTCAGTTGATGAGAAATTTGAATTGCTGGGCATCATG
 
. : . : . : . : . : . :
rJMFF004I02+ GCAAATGTCTTTATTGTTGCTCCTGAAAGCCTTTCCTCTCTGTTTGAGGGAACCCCAAGT
rJMFF042E24+ GCAAATGTCTTTATTGTTGCTCCTGAAAGCCTTTCCTCTCTGTTTGAGGGAACCCCAAGT
rJMFF003J22+ GCAAATGTCTTTATTGTTGCTCCTGAAAGCCTTTCCTCTCTGTTTGAGGGAACCCCAAGT
                      ____________________________________________________________
consensus GCAAATGTCTTTATTGTTGCTCCTGAAAGCCTTTCCTCTCTGTTTGAGGGAACCCCAAGT
 
. : . : . : . : . : . :
rJMFF004I02+ ATTAGGAAAGATGCGCAGAGGTTCATTGAGCTTCGGGATGACTACAAAAGTGCAAAACTT
rJMFF042E24+ ATTAGGAAAGATGCGCAGAGGTTCATTGAGCTTCGGGATGACTACAAAAGTGCAAAACTT
rJMFF003J22+ ATTAGGAAAGATGCGCAGAGGTTCATTGAGCTTCGGGATGACTACAAAAGTGCAAAACTT
                      ____________________________________________________________
consensus ATTAGGAAAGATGCGCAGAGGTTCATTGAGCTTCGGGATGACTACAAAAGTGCAAAACTT
 
. : . : . : . : . : . :
rJMFF004I02+ GCATCTAGATTTAGCTCCTTGTTTGGCTAGAACTCGATACTAAGCGATATGTGTGTAGAG
rJMFF042E24+ GCATCTAGATTTAGCTCCTTGTTTGGCTAGAACTCGATACTAAGCGATATGTGTGTAGAG
rJMFF003J22+ GCATCTAGATTTAGCTCCTTGTTTGGCTAGAACTCGATACTAAGCGATATGTGTGTAGAG
                      ____________________________________________________________
consensus GCATCTAGATTTAGCTCCTTGTTTGGCTAGAACTCGATACTAAGCGATATGTGTGTAGAG
 
. : . : . : . : . : . :
rJMFF004I02+ GCAATGTAACTCTAAAGACTGCTTCGGCTCACAATGTTGTTATGTTTGTACCTAGTACTG
rJMFF042E24+ GCAATGTAACTCTAAAGACTGCTTCGGCTCACAATGTTGTTATGTTTGTACCTAGTACTG
rJMFF003J22+ GCAATGTAACTCTAAAGACTGCTTCGGCTCACAATGTTGTTATGTTTGTACCTAGTACTG
                      ____________________________________________________________
consensus GCAATGTAACTCTAAAGACTGCTTCGGCTCACAATGTTGTTATGTTTGTACCTAGTACTG
 
. : . : . : . : . : . :
rJMFF004I02+ AATGCATTGGGCATTTTGCAAGTGATGATTGGCTCACAATGTTGTTATGTTTGTACCTAG
rJMFF042E24+ AATGCATTGGGCATTTTGCAAGTGATGATTGGCTCACAATGTTGTTATGTTTGTACCTAG
rJMFF003J22+ AATGCATTGGGCATTTTGCAAGTGATGATTGGCTCACAATGTTGTTATGTTTGTACCTAG
                      ____________________________________________________________
consensus AATGCATTGGGCATTTTGCAAGTGATGATTGGCTCACAATGTTGTTATGTTTGTACCTAG
 
. : . : . : . : . : . :
rJMFF004I02+ TACTGAATGCATTGGGCATTTTGCAAGTGATGATTTGACAGTTTCTGTAAGTGAGAGGAT
rJMFF042E24+ TACTGAATGCATTGGGCATTTTGCAAGTGATGATTTGACAGTTTCTGT
rJMFF003J22+ TACTGAATGCATTGGGCATTTTGCAAGTGATGATTTGACAGTTTCTGTAAGTGAGAGGAT
                      ____________________________________________________________
consensus TACTGAATGCATTGGGCATTTTGCAAGTGATGATTTGACAGTTTCTGTAAGTGAGAGGAT