Previous Contig 008277:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003J01Sequence466008277 (9)gb:SOL511792_17158082e-37Spinacia oleracea mRNA for chloroplast envelope quinone-oxidoreductase homologue697008277 (9)gb:AF304461_17843895e-57Triphysaria versicolor quinone-oxidoreductase QR1 mRNA, partial cds.
JMFF013G12Sequence566014314gb:AF304461_17843896e-23Triphysaria versicolor quinone-oxidoreductase QR1 mRNA, partial cds.754008277 (9)pir|T10203|T102032e-67hypothetical protein F25G13.100 - Arabidopsis thaliana>gb:ATCHRIV35_1545065 Arab
JMFF025O03Sequence605008277 (9)gb:SOL511792_17158084e-60Spinacia oleracea mRNA for chloroplast envelope quinone-oxidoreductase homologue706008277 (9)gb:OSJN00179_16962542e-44Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0069D17, complete seque
JMFF033E17Sequence561008277 (9)gb:SOL511792_17158083e-47Spinacia oleracea mRNA for chloroplast envelope quinone-oxidoreductase homologue754008277 (9)pir|T10203|T102032e-67hypothetical protein F25G13.100 - Arabidopsis thaliana>gb:ATCHRIV35_1545065 Arab
JMSF022D01Sequence623008277 (9)gb:SOL511792_17158084e-55Spinacia oleracea mRNA for chloroplast envelope quinone-oxidoreductase homologue752008277 (9)pir|T10203|T102032e-85hypothetical protein F25G13.100 - Arabidopsis thaliana>gb:ATCHRIV35_1545065 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF033E17- GGCTTTG
JMSF022D01- GGATTCATTTCATTTCATACTGTCCGGCTTTG
                      ____________________________________________________________
consensus GGATTCATTTCATTTCATACTGTCCGGCTTTG
 
. : . : . : . : . : . :
JMFF033E17- CAGATTTGCATTCTTCAACTACTTGTTAAAGAGGTGAGAGCTTTTCGGTTCGAGTATGGC
JMFF003J01- ATTCTTCAACTACTTGTTAAAGAGGTGAGAGCTTTTCGGTTCGAGTATGGC
JMSF022D01- CAGATTTGCATTCTTCAACTACTTGTTAAAGAGGTGAGAGCTTTTCGGTTCGAGTATGGC
JMFF025O03- ATTCTTCAACTACTTGTTAAAGAGGTGAGAGCTTTTCGGTTCGAGTATGGC
                      ____________________________________________________________
consensus CAGATTTGCATTCTTCAACTACTTGTTAAAGAGGTGAGAGCTTTTCGGTTCGAGTATGGC
 
. : . : . : . : . : . :
JMFF033E17- TGCCGCCGGGAGGCTTATGCACGCGGTGCAGTACGACAGCTACGGCGGAGGAGCCGCAGC
JMFF003J01- TGCCGCCGGGAGGCTTATGCACGCGGTGCAGTACGACAGCTACGGCGGAGGAGCCGCAGC
JMSF022D01- TGCCGCCGGGAGGCTTATGCACGCGGTGCAGTACGACAGCTACGGCGGAGGAGCCGCAGC
JMFF025O03- TGCCGCCGGGAGGCTTATGCACGCGGTGCAGTACGACAGCTACGGCGGAGGAGCCGCAGC
                      ____________________________________________________________
consensus TGCCGCCGGGAGGCTTATGCACGCGGTGCAGTACGACAGCTACGGCGGAGGAGCCGCAGC
 
. : . : . : . : . : . :
JMFF033E17- TTTGAAGCATGTTGAAGTTGCTGTACCTACTCCCAAGAAAGGTGAGCTCTTGGTGAAGAT
JMFF003J01- TTTGAAGCATGTTGAAGTTGCTGTACCTACTCCCAAGAAAGGTGAGCTCTTGGTGAAGAT
JMSF022D01- TTTGAAGCATGTTGAAGTTGCTGTACCTACTCCCAAGAAAGGTGAGCTCTTGGTGAAGAT
JMFF025O03- TTTGAAGCATGTTGAAGTTGCTGTACCTACTCCCAAGAAAGGTGAGCTCTTGGTGAAGAT
                      ____________________________________________________________
consensus TTTGAAGCATGTTGAAGTTGCTGTACCTACTCCCAAGAAAGGTGAGCTCTTGGTGAAGAT
 
. : . : . : . : . : . :
JMFF033E17- GGAAGCAGTAAGCATAAATCCAATTGATTGGAAAATTCAAACAGGTGCCATTCGACCCAT
JMFF003J01- GGAAGCAGTAAGCATAAATCCAATTGATTGGAAAATTCAAACAGGTGCCATTCGACCCAT
JMSF022D01- GGAAGCAGTAAGCATAAATCCAATTGATTGGAAAATTCAAACAGGTGCCATTCGACCCAT
JMFF025O03- GGAAGCAGTAAGCATAAATCCAATTGATTGGAAAATTCAAACAGGTGCCATTCGACCCAT
                      ____________________________________________________________
consensus GGAAGCAGTAAGCATAAATCCAATTGATTGGAAAATTCAAACAGGTGCCATTCGACCCAT
 
. : . : . : . : . : . :
JMFF033E17- CTTTCCCCGCAAATTTCCTCATATTCCAGCTAGTGATGTAGCGGGAGAAGTAGTGGAGGT
JMFF003J01- CTTTCCCCGCAAATTTCCTCATATTCCAGCTAGTGATGTAGCGGGAGAAGTAGTGGAGGT
JMSF022D01- CTTTCCCCGCAAATTTCCTCATATTCCAGCTAGTGATGTAGCGGGAGAAGTAGTGGAGGT
JMFF025O03- CTTTCCCCGCAAATTTCCTCATATTCCAGCTAGTGATGTAGCGGGAGAAGTAGTGGAGGT
                      ____________________________________________________________
consensus CTTTCCCCGCAAATTTCCTCATATTCCAGCTAGTGATGTAGCGGGAGAAGTAGTGGAGGT
 
. : . : . : . : . : . :
JMFF033E17- TGGTTCTGGTGTTCAAAATTTCAAAGTCGGTGACAAAGTTGTTGCTACAATCAGCACTCG
JMFF003J01- TGGTTCTGGTGTTCAAAATTTCAAAGTCGGTGACAAAGTTGTTGCTACAATCAGCACTCG
JMSF022D01- TGGTTCTGGTGTTCAAAATTTCAAAGTCGGTGACAAAGTTGTTGCTACAATCAGCACTCG
JMFF025O03- TGGTTCTGGTGTTCAAAATTTCAAAGTCGGTGACAAAGTTGTTGCTACAATCAGCACTCG
                      ____________________________________________________________
consensus TGGTTCTGGTGTTCAAAATTTCAAAGTCGGTGACAAAGTTGTTGCTACAATCAGCACTCG
 
. : . : . : . : . : . :
JMFF033E17- TGATGGAGGTGGATTAGCGGAGTATGCTGTGACAAAGGAGAGCTTGACAGCTGCGAGGCC
JMFF003J01- TGATGGAGGTGGATTAGCGGAGTATGCTGTGACAAAGGAGAGCTTGACAGCTGCGAGGCC
JMSF022D01- TGATGGAGGTGGATTAGCGGAGTATGCTGTGACAAAGGAGAGCTTGACAGCTGCGAGGCC
JMFF025O03- TGATGGAGGTGGATTAGCGGAGTATGCTGTGACAAAGGAGAGCTTGACAGCTGCGAGGCC
                      ____________________________________________________________
consensus TGATGGAGGTGGATTAGCGGAGTATGCTGTGACAAAGGAGAGCTTGACAGCTGCGAGGCC
 
. : . : . : . : . : . :
JMFF033E17- ACCCGAAGTATCAGCAGCTGATGCTGCAGCCC-TTCCCATTGCTGGTCTTACAGCTCACG
JMFF003J01- ACCCGAAGTATCAGCAGCTGATGCTGCAGCCC-TTCCCATTGCTGGTCTTACAGCT
JMSF022D01- ACCCGAAGTATCAGCAGCTGATGCTGCAGCCC-TTCCCATTGCTGGTCTTACAGCTCACG
JMFF025O03- ACCCGAAGTATCAGCAGCTGATGCTGCAGCCC-TTCCCATTGCTGGTCTTACAGCTCACG
rJMFF033E17+ CGAAGTATCAGCAGCTGATGCTGCAGCCC-TTCCCATTGCTGGTCTTACAGCTCACG
rJMFF013G12+ CGAAGTATCAGCAGCTGATGCTGCAG-CCNTTCCCATTGCTGGTCTTACAGCTCACG
rJMSF022D01+ AGTATCAGCAGCTGATGCTGCAGCCCTTTCCCATTGCTGGTCTTACAGCTCACG
                      ____________________________________________________________
consensus ACCCGAAGTATCAGCAGCTGATGCTGCAGCCC-TTCCCATTGCTGGTCTTACAGCTCACG
 
. : . : . : . : . : . :
JMFF033E17- AGGCACTAACCCGAATTGCGGGGGTCAAGCTCGACGGGAGCGGTCCTANGAAGAACATCC
JMSF022D01- AGGCACTAACCCGAATTGCGGGGGTCAAGCTCGACGGGAGCGGTCCTAGGAAGAACATCC
JMFF025O03- AGGCACTAACCCGAATTGCGGGGGTCAAGCTCGACGGGAGCGGTCCTAGGAAGAACATCC
rJMFF033E17+ AGGCACTAACCCGAATTGCGGGGGTCAAGCTCGACGGGAGCGGTCCTAGGAAGAACATCC
rJMFF013G12+ AGGCACTAACCCGAATTGCGGGGGTCAAGCTCGACGGGAGCGGTCCTAGGAAGAACATCC
rJMSF022D01+ AGGCACTAACCCGAATTGCGGGGGTCAAGCTCGACGGGAGCGGTCCTAGGAAGAACATCC
rJMFF025O03+ AATTGCGGGGGTCAAGCTCGACGGGAGCGGTCCTAGGAAGAACATCC
rJMFF003J01+ GGGTCAAGCTCGACGGGAGCGGTCNTAGGAAGAACATCC
                      ____________________________________________________________
consensus AGGCACTAACCCGAATTGCGGGGGTCAAGCTCGACGGGAGCGGTCCTAGGAAGAACATCC
 
. : . : . : . : . : . :
JMFF033E17- TTGTGACTGCTGCCT
JMSF022D01- TTGTGACTGCTGCCT-CCGGTGGCGTGGGCCACTACGCTGTCCAGCTGGCAAA
JMFF025O03- TTGTGACTGCTGCCT-CCGGTGGCGTGGGCCACTACGCTGTCCAGCTGGCAAAGCTGGGG
rJMFF033E17+ TTGTGACTGCTGCCTCCCGGTGGCGTGGGCCACTACGCTGTCCAGCTGGCAAAGCTGGGG
rJMFF013G12+ TTGTGACTGCTGCCTCCCGGTGGCGTGGGCCACTACGCTGTCCAGCTGGCAAAGCTGGGG
rJMSF022D01+ TTGTGACTGCTGCCT-CCGGTGGCGTGGGCCACTACGCTGTCCAGCTGGCAAAGCTGGGG
rJMFF025O03+ TTGTGACTGCTGCCTCCCGGTGGCGTGGGCCACTACGCTGTCCAGCTGGCAAAGCTGGGG
rJMFF003J01+ TTGTGACTGCTGCCT-CCGGTGGCGTGGGCCACTACGCTGTCCAGCTGGCAAAGCTGGGG
                      ____________________________________________________________
consensus TTGTGACTGCTGCCT-CCGGTGGCGTGGGCCACTACGCTGTCCAGCTGGCAAAGCTGGGG
 
. : . : . : . : . : . :
JMFF025O03- AACACACACGTCACAG
rJMFF033E17+ AACACACACGTCACAGCCACGTGTGGGGCACGCAACATCGAGTTCGTGAAGAGCTTAGGC
rJMFF013G12+ AACACACACGTCACAGCCACGTGTGGGGCACGCAACATCGAGTTCGTGAAGAGCTTAGGC
rJMSF022D01+ AACACACACGTCACAGCCACGTGTGGGGCACGCAACATCGAGTTCGTGAAGAGCTTAGGC
rJMFF025O03+ AACACACACGTCACAGCCACGTGTGGGGCACGCAACATCGAGTTCGTGAAGAGCTTAGGC
rJMFF003J01+ AACACACACGTCACAGCCACGTGTGGGGCACGCAACATCGAGTTCGTGAAGAGCTTAGGC
                      ____________________________________________________________
consensus AACACACACGTCACAGCCACGTGTGGGGCACGCAACATCGAGTTCGTGAAGAGCTTAGGC
 
. : . : . : . : . : . :
rJMFF033E17+ GCAGACGAGGTCCTCGACTACAAGACCCCCGAGGGCACAGCTCTTCACAGCTCATCGGGC
rJMFF013G12+ GCAGACGAGGTCCTCGACTACAAGACCCCCGAGGGCACAGCTCTTCACAGCTCATCGGGC
rJMSF022D01+ GCAGACGAGGTCCTCGACTACAAGACCCCCGAGGGCACAGCTCTTCACAGCTCATCGGGC
rJMFF025O03+ GCAGACGAGGTCCTCGACTACAAGACCCCCGAGGGCACAGCTCTTCACAGCTCATCGGGC
rJMFF003J01+ GCAGACGAGGTCCTCGACTACAAGACCCCCGAGGGCACAGCTCTTCACAGCTCATCGGGC
                      ____________________________________________________________
consensus GCAGACGAGGTCCTCGACTACAAGACCCCCGAGGGCACAGCTCTTCACAGCTCATCGGGC
 
. : . : . : . : . : . :
rJMFF033E17+ CAGAAATACGACGCTGTCATCCACTGCACCTCGGGAATTCCCTGGTCTACCTTCGAGCCC
rJMFF013G12+ CAGAAATACGACGCTGTCATCCACTGCACCTCGGGAATTCCCTGGTCTACCTTCGAGCCC
rJMSF022D01+ CAGAAATACGACGCTGTCATCCACTGCACCTCGGGAATTCCCTGGTCTACCTTCGAGCCC
rJMFF025O03+ CAGAAATACGACGCTGTCATCCACTGCACCTCGGGAATTCCCTGGTCTACCTTCGAGCCC
rJMFF003J01+ CAGAAATACGACGCTGTCATCCACTGCACCTCGGGAATTCCCTGGTCTACCTTCGAGCCC
                      ____________________________________________________________
consensus CAGAAATACGACGCTGTCATCCACTGCACCTCGGGAATTCCCTGGTCTACCTTCGAGCCC
 
. : . : . : . : . : . :
rJMFF033E17+ AATCTCAGCGACAACGGCAAGGTAATCGATTTCACTCCCACCCCCGCCGCCCTCTTAACG
rJMFF013G12+ AATCTCAGCGACAACGGCAAGGTAATCGATTTCACTCCCACCCCCGCCGCCCTCTTAACG
rJMSF022D01+ AATCTCAGCGACAACGGCAAGGTAATCGATTTCACTCCCACCCCCGCCGCCATCTTAACG
rJMFF025O03+ AATCTCAGCGACAACGGCAAGGTAATCGATTTCACTCCCACCCCCGCCGCCCTCTTAACG
rJMFF003J01+ AATCTCAGCGACAACGGCAAGGTAATCGATTTCACTCCCACCCCCGCCGCCCTCTTAACG
                      ____________________________________________________________
consensus AATCTCAGCGACAACGGCAAGGTAATCGATTTCACTCCCACCCCCGCCGCCCTCTTAACG
 
. : . : . : . : . : . :
rJMFF033E17+ TTCGCCCTCAAGAAGCTCACCTTCTCAAAGAAGCAGCTGGTGCCAATGATTTTATCTGCC
rJMFF013G12+ TTCGCCCTCAAGAAGCTCACCTTCTCAAAGAAGCAGCTGGTGCCAATGATTTTATCTGCC
rJMSF022D01+ TTCGCCCTCAAGAAGCTCACCTTCTCAAAGAAGCAGCTGGTGCCAATGATTTTATCTGCC
rJMFF025O03+ TTCGCCCTCAAGAAGCTCACCTTCTCAAAGAAGCAGCTGGTGCCAATGATTTTATCTGCC
rJMFF003J01+ TTCGCCCTCAAGAAGCTCACCTTCTCAAAGAAGCAGCTGGTGCCAATGATTTTATCTGCC
                      ____________________________________________________________
consensus TTCGCCCTCAAGAAGCTCACCTTCTCAAAGAAGCAGCTGGTGCCAATGATTTTATCTGCC
 
. : . : . : . : . : . :
rJMFF033E17+ AAAGCTGAGAACCTGGACTATCTGGTTAAACTAGTGAAAGAGGGGAAGCTTAAAAGTGTT
rJMFF013G12+ AAAGCTGAGAACCTGGACTATCTGGTTAAACTAGTGAAAGAGGGGAAGCTTAAAAGTGTT
rJMSF022D01+ AAAGCTGAGAACCTGGACTATCTGGTTAAACTAGTGAAAGAGGGGAAGCTTAAAAGTGTT
rJMFF025O03+ -AAGCTGAGAACCTGGACTATCTGGTTAAACTAGTGAAAGAGGGGAAGCTTAAAAGTGTT
rJMFF003J01+ -AAGCTGAGAACCTGGACTATCTGGTTAAACTAGTGAAAGAGGGGAAGCTTAAAAGTGTT
                      ____________________________________________________________
consensus AAAGCTGAGAACCTGGACTATCTGGTTAAACTAGTGAAAGAGGGGAAGCTTAAAAGTGTT
 
. : . : . : . : . : . :
rJMFF033E17+ ATAGACTCAAAACACCCTCTGAGCAAGGCAGAAGATGCTTGGACTAGGAGCATTGAGGGG
rJMFF013G12+ ATAGACTCAAAACACCCTCTGAGCAAGGCAGAAGATGCTTGGACTAGGAGCATTGAGGGG
rJMSF022D01+ ATAGACTCAAAACACCCTCTGAGCAAGGCAGAAGATGCTTGGACTAGGAGCATTGAGGGG
rJMFF025O03+ ATAGACTCAAAACACCCTCTGAGCAAGGCAGAAGATGCTTGGACTAGGAGCATTGAGGGG
rJMFF003J01+ ATAGACTCAAAACACCCTCTGAGCAAGGCAGAAGATGCTTGGACTAGGAGCATTGAGGGG
                      ____________________________________________________________
consensus ATAGACTCAAAACACCCTCTGAGCAAGGCAGAAGATGCTTGGACTAGGAGCATTGAGGGG
 
. : . : . : . : . : . :
rJMFF033E17+ CATGCCACGGGGAAGATAATTGTGGAGCCATAAAACAATATGTATAATGTTGTATGTTTT
rJMFF013G12+ CATGCCACGGGGAAGATAATTGTGGAGCCATAAAACAATATGTATAATGTTGTATGTTTT
rJMSF022D01+ CATGCCACGGGGAAGATAATTGTGGAGCCATAAAACAATATGTATAATGTTGTATGTTTT
rJMFF025O03+ CATGCCACGGGGAAGATAATTGTGGAGCCATAAAACAATATGTATAATGTTGTATGTTTT
rJMFF003J01+ CATGCCACGGGGAAGATAATTGTGGAGCCATAAAACAATATGTATAATGTTGTATGTTTT
                      ____________________________________________________________
consensus CATGCCACGGGGAAGATAATTGTGGAGCCATAAAACAATATGTATAATGTTGTATGTTTT
 
. : . : . : . : . : . :
rJMFF033E17+ AAAATGGATGTGTGGTGTGTTAATGTCCTCAAGAACCATGTATTTGGAACCATTACAAGG
rJMFF013G12+ AAAATGGATGTGTGGTGTGTTAATGTCCTCAAGAACCATGTATTTGGAACCATTACAAGG
rJMSF022D01+ AAAATGGATGTGTGGTGTGTTAATGTCCTCAAGAACCATGTATTTGGAACCATTACAAGG
rJMFF025O03+ AAAATGGATGTGTGGTGTGTTAATGTCCTCAAGAACCATGTATTTGGAACCATTACAAGG
rJMFF003J01+ AAAATGGATGTGTGGTGTGTTAATGTCCTCAAGAACCATGTATTTGGAACCATTACAAGG
                      ____________________________________________________________
consensus AAAATGGATGTGTGGTGTGTTAATGTCCTCAAGAACCATGTATTTGGAACCATTACAAGG
 
. : . : . : . : . : . :
rJMFF033E17+ TTGTGCTAATGTATCATGTATGATGTAACTAGGAATAT
rJMFF013G12+ TTGTGCTAATGTATCATGTATGATGTAACTAGGAATAT
rJMSF022D01+ TTGTGCTAATGTATCATGTATGATGTAACTAGGAATAT
rJMFF025O03+ TTGTGCTAATGTATCATGTATGATGTAACTAGGAATATGCTATAGTTGTTCATATCATAT
rJMFF003J01+ TTGTGCTAATGTATCATGTATGATGTAACTAGGAATATGCTATAGTTGTTCATATCATAT
                      ____________________________________________________________
consensus TTGTGCTAATGTATCATGTATGATGTAACTAGGAATATGCTATAGTTGTTCATATCATAT