Previous Contig 008276:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003I18Sequence605008276 (4)gb:AY048216_15616782e-59Arabidopsis thaliana AT5g52970/MNB8_3 mRNA, complete cds.>gb:AY091710_1574721 Ar707008276 (4)gb:AY048216_15616789e-76Arabidopsis thaliana AT5g52970/MNB8_3 mRNA, complete cds.>gb:AY091710_1574721 Ar
JMSF002E03Sequence333008276 (4)gb:AY048216_15616787e-08Arabidopsis thaliana AT5g52970/MNB8_3 mRNA, complete cds.>gb:AY091710_1574721 Ar752008276 (4)gb:AY048216_15616781e-75Arabidopsis thaliana AT5g52970/MNB8_3 mRNA, complete cds.>gb:AY091710_1574721 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF002E03- GTGGATTTTGGAATGGCCTCCTCGCATCTTCTTCTTCCTCCACTCTG
JMFF003I18- AGTGTGGATTTTGGAATGGCCTCCTCGCATCTTCTTCTTCCTCCACTCTG
                      ____________________________________________________________
consensus AGTGTGGATTTTGGAATGGCCTCCTCGCATCTTCTTCTTCCTCCACTCTG
 
. : . : . : . : . : . :
JMSF002E03- TATATCTCTTTCAGCTCCAGACCATTCCCATTCCAGTAGCCCCAGAAAAGCATTGC-TTT
JMFF003I18- TATATCTCTTTCAGCTCCAGACCATTCCCATTCCAGTAGCCCCAGAAAAGCATTGC-TTT
rJMSF002E03+ CAGCTCCAGACCATTCCCATTCCAGTAGCCCCAGAAAAGCATTGCTTTT
                      ____________________________________________________________
consensus TATATCTCTTTCAGCTCCAGACCATTCCCATTCCAGTAGCCCCAGAAAAGCATTGC-TTT
 
. : . : . : . : . : . :
JMSF002E03- CCCATTCCAAACACAAACAGGCTATCCAAACCCAGAAGAAGCCAATCAAAGTAAATGCTG
JMFF003I18- CCCATTCCAAACACAAACAGGCTATCCAAACCCAGAAGAAGCCAATCAAAGTAAATGCTG
rJMSF002E03+ CCCATTCCAAACACAAACAGGCTATCCAAACCCAGAAGAAGCCAATCAAAGTAAATGCTG
rJMFF003I18+ CAAACAGGCTATCCAAACCCAGAAGAAGCCAATCAAAGTAAATGCTG
                      ____________________________________________________________
consensus CCCATTCCAAACACAAACAGGCTATCCAAACCCAGAAGAAGCCAATCAAAGTAAATGCTG
 
. : . : . : . : . : . :
JMSF002E03- GTTTGCAATCCAAGACTGTGAATTTCTTGCTCTCTGGCTCTCTGGCTCTCGCTCTGTCCT
JMFF003I18- GTTTGCAATCCAAGACTGTGAATTTCTTGCTCTCTGGCTCTCTGGCTCTCGCTCTGTCCT
rJMSF002E03+ GTTTGCAATCCAAGACTGTGAATTTCTTGCTCTCTGGCTCTCTGGCTCTCGCTCTGTCCT
rJMFF003I18+ GTTTGCAATCCAAGACTGTGAATTTCTTGCTCTCTGGCTCTCTGGCTCTCGCTCTGTCCT
                      ____________________________________________________________
consensus GTTTGCAATCCAAGACTGTGAATTTCTTGCTCTCTGGCTCTCTGGCTCTCGCTCTGTCCT
 
. : . : . : . : . : . :
JMSF002E03- TCTCAGGAGTTGGATTTGCGGAGGGGAAGGTAGGGGTTAACAAGCCGGAAATGCTTCCTA
JMFF003I18- TCTCAGGAGTTGGATTTGCGGAGGGGAAGGTAGGGGTTAACAAGCCGGAAATGCTTCCTA
rJMSF002E03+ TCTCAGGAGTTGGATTTGCGGAGGGGAAGGTAGGGGTTAACAAGCCGGAAATGCTTCCTA
rJMFF003I18+ TCTCAGGAGTTGGATTTGCGGAGGGGAAGGTAGGGGTTAACAAGCCGGAAATGCTTCCTA
                      ____________________________________________________________
consensus TCTCAGGAGTTGGATTTGCGGAGGGGAAGGTAGGGGTTAACAAGCCGGAAATGCTTCCTA
 
. : . : . : . : . : . :
JMSF002E03- AGGAGTTTACCACTGTTATTGATGTTGCTGGATTTCTCTCAGATGG
JMFF003I18- AGGAGTTTACCACTGTTATTGATGTTGCTGGATTTCTCTCAGATGGCCAGGAGAAAAGAC
rJMSF002E03+ AGGAGTTTACCACTGTTATTGATGTTGCTGGATTTCTCTCAGATGGCCAGGAGAAAAGAC
rJMFF003I18+ AGGAGTTTACCACTGTTATTGATGTTGCTGGATTTCTCTCAGATGGCCAGGAGAAAAGAC
                      ____________________________________________________________
consensus AGGAGTTTACCACTGTTATTGATGTTGCTGGATTTCTCTCAGATGGCCAGGAGAAAAGAC
 
. : . : . : . : . : . :
JMFF003I18- TTGCACAGGAGATTGCAGATATCGAAAAGGATACTGGATTCAAGTTGAGAGTTTTGGCTC
rJMSF002E03+ TTGCACAGGAGATTGCAGATATCGAAAAGGATACTGGATTCAAGTTGAGAGTTTTGGCTC
rJMFF003I18+ TTGCACAGGAGATTGCAGATATCGAAAAGGATACTGGATTCAAGTTGAGAGTTTTGGCTC
                      ____________________________________________________________
consensus TTGCACAGGAGATTGCAGATATCGAAAAGGATACTGGATTCAAGTTGAGAGTTTTGGCTC
 
. : . : . : . : . : . :
JMFF003I18- AGAACTACCCTGAAACGCCAGGATTAGCAATCAAGGATTTCTGGGAAGTGGATGACAGGA
rJMSF002E03+ AGAACTACCCTGAAACGCCAGGATTAGCAATCAAGGATTTCTGGGAAGTGGATGACAGGA
rJMFF003I18+ AGAACTACCCTGAAACGCCAGGATTAGCAATCAAGGATTTCTGGGAAGTGGATGACAGGA
                      ____________________________________________________________
consensus AGAACTACCCTGAAACGCCAGGATTAGCAATCAAGGATTTCTGGGAAGTGGATGACAGGA
 
. : . : . : . : . : . :
JMFF003I18- CTATAGTCTTCGTTGCTGATCCTACTTTTGGCAACATACTAAACTTCAATGTTGGAGCGT
rJMSF002E03+ CTATAGTCTTCGTTGCTGATCCTACTTTTGGCAACATACTAAACTTCAATGTTGGAGCGT
rJMFF003I18+ CTATAGTCTTCGTTGCTGATCCTACTTTTGGCAACATACTAAACTTCAATGTTGGAGCGT
                      ____________________________________________________________
consensus CTATAGTCTTCGTTGCTGATCCTACTTTTGGCAACATACTAAACTTCAATGTTGGAGCGT
 
. : . : . : . : . : . :
JMFF003I18- CTGTGGATCTAGACATTCCGCGTAGCTTCTGGAGCCGTTTGGCTGGAAAATATGGGAACA
rJMSF002E03+ CTGTGGATCTAGACATTCCGCGTAGCTTCTGGAGCCGTTTGGCTGGGAAATATGGGAACA
rJMFF003I18+ CTGTGGATCTAGACATTCCGCGTAGCTTCTGGAGCCGTTTGGCTGGAAAATATGGGAACA
                      ____________________________________________________________
consensus CTGTGGATCTAGACATTCCGCGTAGCTTCTGGAGCCGTTTGGCTGGAAAATATGGGAACA
 
. : . : . : . : . : . :
JMFF003I18- TATTTTATTGGAAGGA
rJMSF002E03+ TATTTTATTGGAAGGAAAAGGGTGAAGATGCGTCTATTGAATCTGCTGTTATGGCAATAT
rJMFF003I18+ TATTTTATTGGAAGGAAAAGGGTGAAGATGCGTCTATTGAATCTGCTGTTATGGCAATAT
                      ____________________________________________________________
consensus TATTTTATTGGAAGGAAAAGGGTGAAGATGCGTCTATTGAATCTGCTGTTATGGCAATAT
 
. : . : . : . : . : . :
rJMSF002E03+ CAGCCTGCTTGAGAGAACCAGTGGGCGCAAATAATTGCTCAGAGGTAAAGTAATTCCATG
rJMFF003I18+ CAGCCTGCTTGAGAGAACCAGTGGGCGCAAATAATTGCTCAGAGGTAAAGTAATTCCATG
                      ____________________________________________________________
consensus CAGCCTGCTTGAGAGAACCAGTGGGCGCAAATAATTGCTCAGAGGTAAAGTAATTCCATG
 
. : . : . : . : . : . :
rJMSF002E03+ ATTTTGCAATGCATGTTAGGATGTGATGTAGATTTCCATGTCATTTGAAGCAATATATAG
rJMFF003I18+ ATTTTGCAATGCATGTTAGGATGTGATGTAGATTTCCATGTCATTTGAAGCAATATATAG
                      ____________________________________________________________
consensus ATTTTGCAATGCATGTTAGGATGTGATGTAGATTTCCATGTCATTTGAAGCAATATATAG
 
. : . : . : . : . : . :
rJMSF002E03+ TTAATTATTTTCTTCAAACTTAAACGAGAAAGCACATTTAGTT
rJMFF003I18+ TTAATTATTTTCTTCAAACTTAAACGAGAAAGCACATTTAGTTAGTTATTCTACAAGACT
                      ____________________________________________________________
consensus TTAATTATTTTCTTCAAACTTAAACGAGAAAGCACATTTAGTTAGTTATTCTACAAGACT