Previous Contig 008269:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003F24Sequence547005172 (2)gb:AY065026_15661871e-25Arabidopsis thaliana AT5g53140/MFH8_8 mRNA, complete cds.>gb:AY133656_1581479 Ar708008269 (2)gb:AC098598_17367818e-46Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1007_H05, complete s
JMSF010K06Sequence408005172 (2)743008269 (2)gb:AY045819_15613331e-48Arabidopsis thaliana putative protein phosphatase 2C (At5g53140) mRNA, complete

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF010K06+ ATCTATATGTTGCCAACGTTGGTGATTCA
                      ____________________________________________________________
consensus ATCTATATGTTGCCAACGTTGGTGATTCA
 
. : . : . : . : . : . :
rJMSF010K06+ AGAACCATGTGTCAAAAAAAGGAAAAGCAATTCCTCTCTCTCAGGATCATAAACCAAATA
rJMFF003F24+ CAAAAAAAGGAAAAGCAATTCNTCTCTCTCAGGATCATAAACCAAATA
                      ____________________________________________________________
consensus AGAACCATGTGTCAAAAAAAGGAAAAGCAATTCCTCTCTCTCAGGATCATAAACCAAATA
 
. : . : . : . : . : . :
rJMSF010K06+ GAAGTGATGAGAGAAAGAGGATTGAAAATGCTGGAGGTGTTATTATGTGGGCAGGCACTT
rJMFF003F24+ GAAGTGATGAGAGAAAGAGGATTGAAAATGCTGGAGGTGTTATTATGTGGGCAGGCACTT
                      ____________________________________________________________
consensus GAAGTGATGAGAGAAAGAGGATTGAAAATGCTGGAGGTGTTATTATGTGGGCAGGCACTT
 
. : . : . : . : . : . :
rJMSF010K06+ GGAGAGTTGGAGGAGTCTTGGCAATGTCCCGTGCCTTTGGTAATCGAATGCTGAAGCAAT
rJMFF003F24+ GGAGAGTTGGAGGAGTCTTGGCAATGTCCCGTGCCTTTGGTAATCGAATGCTGAAGCAAT
                      ____________________________________________________________
consensus GGAGAGTTGGAGGAGTCTTGGCAATGTCCCGTGCCTTTGGTAATCGAATGCTGAAGCAAT
 
. : . : . : . : . : . :
rJMSF010K06+ ATGTTGTGGCTGAACCTGAGATTCAGGAAGAAGTCATTGATGAAGAATTAGAATTGCTTG
rJMFF003F24+ ATGTTGTGGCTGAACCTGAGATTCAGGAAGAAGTCATTGATGAAGAATTAGAATTGCTTG
                      ____________________________________________________________
consensus ATGTTGTGGCTGAACCTGAGATTCAGGAAGAAGTCATTGATGAAGAATTAGAATTGCTTG
 
. : . : . : . : . : . :
rJMSF010K06+ TCCTGGCTAGTGATGGACTCTGGGATGTAGTACCCAATGAGGATGCCGTTTCACTAGCAG
rJMFF003F24+ TCCTGGCTAGTGATGGACTCTGGGATGTAGTACCCAATGAGGATGCCGTTTCACTAGCAG
                      ____________________________________________________________
consensus TCCTGGCTAGTGATGGACTCTGGGATGTAGTACCCAATGAGGATGCCGTTTCACTAGCAG
 
. : . : . : . : . : . :
rJMSF010K06+ AGTCGGAAGAATCACCCGAAGCAGCTGCGAGGAAGCTGACGGAGACTGCTTTTACCCGTG
rJMFF003F24+ AGTCGGAAGAATCACCCGAAGCAGCTGCGAGGAAGCTGACGGAGACTGCTTTTACCCGTG
                      ____________________________________________________________
consensus AGTCGGAAGAATCACCCGAAGCAGCTGCGAGGAAGCTGACGGAGACTGCTTTTACCCGTG
 
. : . : . : . : . : . :
rJMSF010K06+ GCAGTGCTGACAATATCACCTGCATCGTGGTGAAGTTCCATCACAAGAAGGCGGAGCCTG
rJMFF003F24+ GCAGTGCTGACAATATCACCTGCATCGTGGTGAAGTTCCATCACAAGAAGGCGGAGCCTG
                      ____________________________________________________________
consensus GCAGTGCTGACAATATCACCTGCATCGTGGTGAAGTTCCATCACAAGAAGGCGGAGCCTG
 
. : . : . : . : . : . :
rJMSF010K06+ AGGTAAGCCAACAGGAAGCAAAGAGCTTGTCGACTTCACCTGCACATAATTTTTAAATTA
rJMFF003F24+ AGGTAAGCCAACAGGAAGCAAAGAGCTTGTCGACTTCACCTGCACATAATTTTTAAATTA
                      ____________________________________________________________
consensus AGGTAAGCCAACAGGAAGCAAAGAGCTTGTCGACTTCACCTGCACATAATTTTTAAATTA
 
. : . : . : . : . : . :
rJMSF010K06+ TGTAGGCAATCTCGTGCAAAGTGCTAGCTTAGCTCGATGCACCAGCAGCTGGTTTCAACG
rJMFF003F24+ TGTAGGCAATCTCGTGCAAAGTGCTAGCTTAGCTCGATGCACCAGCAGCTGGTTTCAACG
                      ____________________________________________________________
consensus TGTAGGCAATCTCGTGCAAAGTGCTAGCTTAGCTCGATGCACCAGCAGCTGGTTTCAACG
 
. : . : . : . : . : . :
rJMSF010K06+ CAATGGAGGCTGCCATGCTGCAGTTATTTGTTTATTCATTTTTCATTTTCTCTTTATAAT
rJMFF003F24+ CAATGGAGGCTGCCATGCTGCAGTTATTTGTTTATTCATTTTTCATTTTCTCTTTATAAT
                      ____________________________________________________________
consensus CAATGGAGGCTGCCATGCTGCAGTTATTTGTTTATTCATTTTTCATTTTCTCTTTATAAT
 
. : . : . : . : . : . :
rJMSF010K06+ TTAATGTTCTTGTTTTCGTCTGTATTTGGACCTGGTGTATCTGCTTGTGATGGTTTGTGT
rJMFF003F24+ TTAATGTTCTTGTTTTCGTCTGTATTTGGACCTGGTGTATCTGCTTGTGATGGTTTGTGT
                      ____________________________________________________________
consensus TTAATGTTCTTGTTTTCGTCTGTATTTGGACCTGGTGTATCTGCTTGTGATGGTTTGTGT
 
. : . : . : . : . : . :
rJMSF010K06+ TTCTCCCCTTCTGTAGAGTTAATATCTGATCAGTTAAAACATAACCAGCGGGAT
rJMFF003F24+ TTCTCCCCTTCTGTAGAGTTAATATCTGATCAGTTAAAACATAACCAGCGGGATGTAGTT
                      ____________________________________________________________
consensus TTCTCCCCTTCTGTAGAGTTAATATCTGATCAGTTAAAACATAACCAGCGGGATGTAGTT