Previous Contig 008261:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003D01Sequence389008261 (2)gb:AP004027_18365760.014Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OJ11677008261 (2)pir|C86157|C861573e-20hypothetical protein T14P4.1 - Arabidopsis thaliana>gb:AE005172_889292 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF003D01- ACTGTATCTCTCTCTCA
rJMFF003D01+ ACTGTATCTCTCTCTCA
                      ____________________________________________________________
consensus ACTGTATCTCTCTCTCA
 
. : . : . : . : . : . :
JMFF003D01- ATTGACCTTTCACATTCTTCTTCTTCTCCTCTTTCTGCGTTAAACAATGTTGTCTCTGTA
rJMFF003D01+ ATTGACCTTTCACATTCTTCTTCTTCTCCTCTTTCTGCGTTAAACAATGTTGTCTCTGTA
                      ____________________________________________________________
consensus ATTGACCTTTCACATTCTTCTTCTTCTCCTCTTTCTGCGTTAAACAATGTTGTCTCTGTA
 
. : . : . : . : . : . :
JMFF003D01- GATCATTATAGCGACAAAGAAAGAGAGATAGGGAGGGGATTGGGGATTCTTGGAAAACCC
rJMFF003D01+ GATCATTATAGCGACAAAGAAAGAGAGATAGGGAGGGGATTGGGGATTCTTGGAAAACCC
                      ____________________________________________________________
consensus GATCATTATAGCGACAAAGAAAGAGAGATAGGGAGGGGATTGGGGATTCTTGGAAAACCC
 
. : . : . : . : . : . :
JMFF003D01- ATATTGTAAGAATTGAATATGAATACTTGTATGGTTGTTTTTGTTTTGATTATTGGATTA
rJMFF003D01+ ATATTGTAAGAATTGAATATGAATACTTGTATGGTTGTTTTTGTTTTGATTATTGGATTA
                      ____________________________________________________________
consensus ATATTGTAAGAATTGAATATGAATACTTGTATGGTTGTTTTTGTTTTGATTATTGGATTA
 
. : . : . : . : . : . :
JMFF003D01- GTGTTGTTTGGGTGTGTTGGGATTAGGAGTTTTCTGGAGATTAATGAGGGAGAGGACGGT
rJMFF003D01+ GTGTTGTTTGGGTGTGTTGGGATTAGGAGTTTTCTGGAGATTAATGAGGGAGAGGACGGT
                      ____________________________________________________________
consensus GTGTTGTTTGGGTGTGTTGGGATTAGGAGTTTTCTGGAGATTAATGAGGGAGAGGACGGT
 
. : . : . : . : . : . :
JMFF003D01- GGTGGGTTTGGGTTTTTTTANGCGCCAAAGTATTGGAACGGCANGGGCTGAATCGGGATG
rJMFF003D01+ GGTGGGTTTGGGTTTTTTTAGGCGCCAAAGTATTGGAACGGCAGGGGCTGAATCGGGATG
                      ____________________________________________________________
consensus GGTGGGTTTGGGTTTTTTTAGGCGCCAAAGTATTGGAACGGCAGGGGCTGAATCGGGATG
 
. : . : . : . : . : . :
JMFF003D01- GCNANATGGTGATANATCTCCGGCAATGGCGANATGGGAATTACCGGAGCAAAATCNANA
rJMFF003D01+ GCGAGATGGTGATAGATCTCCGGCAATGGCGAGATGGGAATTACCGGAGCAAAATCGAGA
                      ____________________________________________________________
consensus GCGAGATGGTGATAGATCTCCGGCAATGGCGAGATGGGAATTACCGGAGCAAAATCGAGA
 
. : . : . : . : . : . :
JMFF003D01- GGTGGATG
rJMFF003D01+ GGTGGATGGAGGTTCAACGGAAGAGGAGAATATATGAGCTGGTGTCTTTGCTACCGTTCC
                      ____________________________________________________________
consensus GGTGGATGGAGGTTCAACGGAAGAGGAGAATATATGAGCTGGTGTCTTTGCTACCGTTCC
 
. : . : . : . : . : . :
rJMFF003D01+ TAGCCTGCTGGTGTTCGCCGGAAACCTGGAGCCCATTGATCACCAGTGGAACCAGCACGG
                      ____________________________________________________________
consensus TAGCCTGCTGGTGTTCGCCGGAAACCTGGAGCCCATTGATCACCAGTGGAACCAGCACGG
 
. : . : . : . : . : . :
rJMFF003D01+ TCTCGACGGCGACGACGTGAAGGGCTCTTGCCGGTCGCTCCATCCCGGTCCGTGAGCCTT
                      ____________________________________________________________
consensus TCTCGACGGCGACGACGTGAAGGGCTCTTGCCGGTCGCTCCATCCCGGTCCGTGAGCCTT
 
. : . : . : . : . : . :
rJMFF003D01+ CTGCATTAGAGCGATTCGTGGAGGGTTTCTTGCGAAGTCAAAGTCCTCCGATCTGTGCTG
                      ____________________________________________________________
consensus CTGCATTAGAGCGATTCGTGGAGGGTTTCTTGCGAAGTCAAAGTCCTCCGATCTGTGCTG
 
. : . : . : . : . : . :
rJMFF003D01+ ATATGGAATTACGTATCAAAATTCTACGTTGTACTGATTCGAAATTCATCAGGAAAGAAA
                      ____________________________________________________________
consensus ATATGGAATTACGTATCAAAATTCTACGTTGTACTGATTCGAAATTCATCAGGAAAGAAA